Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14843410276(98.3007%)
Q30 bases: 14379354459(95.2275%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14783778920(97.9058%)
Q30 bases: 14190653082(93.9778%)

Read1 after filtering:
total reads: 97154391
total bases: 12462746248
Q20 bases: 12408487357(99.5646%)
Q30 bases: 12206305659(97.9423%)

Read2 after filtering:
total reads: 97154391
total bases: 12474609120
Q20 bases: 12384627591(99.2787%)
Q30 bases: 12117695472(97.1389%)

Filtering result:
reads passed filter: 194308782
reads failed due to low quality: 2939824
reads failed due to too many N: 487492
reads failed due to too short: 2263902
reads with adapter trimmed: 114877652
bases trimmed due to adapters: 4491261121

Duplication rate: 30.4688%

Insert size peak (evaluated by paired-end reads): 119

JSON report: V4_0001_RNA_0005_23H5VFLT4_s30.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s30.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s30_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s30_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s30_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s30_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s30.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s30.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 209 seconds