File Info

Filename
V4_0001_RNA_0005_23H5VFLT4_s47.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23H5VFLT4/nfcore_rnafusion_100M__5f1fa79--20260304-093157/fastp/V4_0001_RNA_0005_23H5VFLT4_s47.fastp.log
Size
1.6 KB
Published
Mar 04, 2026 11:41 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14760813206(97.7537%)
Q30 bases: 14255475226(94.4071%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14741352376(97.6249%)
Q30 bases: 14099259149(93.3726%)

Read1 after filtering:
total reads: 97137413
total bases: 12178961988
Q20 bases: 12125681820(99.5625%)
Q30 bases: 11924391706(97.9098%)

Read2 after filtering:
total reads: 97137413
total bases: 12195295444
Q20 bases: 12103391375(99.2464%)
Q30 bases: 11836905537(97.0612%)

Filtering result:
reads passed filter: 194274826
reads failed due to low quality: 3232768
reads failed due to too many N: 462894
reads failed due to too short: 2029512
reads with adapter trimmed: 124413173
bases trimmed due to adapters: 5055124703

Duplication rate: 33.4844%

Insert size peak (evaluated by paired-end reads): 109

JSON report: V4_0001_RNA_0005_23H5VFLT4_s47.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s47.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s47_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s47_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s47_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s47_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s47.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s47.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 292 seconds