Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14814602221(98.1099%)
Q30 bases: 14369927200(95.1651%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14608289392(96.7436%)
Q30 bases: 13945009574(92.3511%)

Read1 after filtering:
total reads: 97654491
total bases: 12634303689
Q20 bases: 12581864136(99.5849%)
Q30 bases: 12380241884(97.9891%)

Read2 after filtering:
total reads: 97654491
total bases: 12645747149
Q20 bases: 12555215244(99.2841%)
Q30 bases: 12282037294(97.1239%)

Filtering result:
reads passed filter: 195308982
reads failed due to low quality: 2766834
reads failed due to too many N: 504448
reads failed due to too short: 1419736
reads with adapter trimmed: 110904433
bases trimmed due to adapters: 4279932762

Duplication rate: 28.3744%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s36.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s36.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s36_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s36_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s36_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s36_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s36.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s36.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 213 seconds