Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14880621940(98.5472%)
Q30 bases: 14440407730(95.6318%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14768164546(97.8024%)
Q30 bases: 14150224419(93.7101%)

Read1 after filtering:
total reads: 97730504
total bases: 12465336039
Q20 bases: 12410567347(99.5606%)
Q30 bases: 12205538389(97.9158%)

Read2 after filtering:
total reads: 97730504
total bases: 12478856697
Q20 bases: 12385078145(99.2485%)
Q30 bases: 12110598007(97.0489%)

Filtering result:
reads passed filter: 195461008
reads failed due to low quality: 2907312
reads failed due to too many N: 484672
reads failed due to too short: 1147008
reads with adapter trimmed: 118584853
bases trimmed due to adapters: 4639525073

Duplication rate: 23.1704%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s05.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s05.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s05_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s05_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s05_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s05_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s05.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s05.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 206 seconds