Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14817635391(98.13%)
Q30 bases: 14361593195(95.1099%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14769328741(97.8101%)
Q30 bases: 14158431478(93.7644%)

Read1 after filtering:
total reads: 97724214
total bases: 12515309668
Q20 bases: 12459854670(99.5569%)
Q30 bases: 12252373433(97.8991%)

Read2 after filtering:
total reads: 97724214
total bases: 12529749513
Q20 bases: 12434467010(99.2395%)
Q30 bases: 12157448031(97.0287%)

Filtering result:
reads passed filter: 195448428
reads failed due to low quality: 3061592
reads failed due to too many N: 486388
reads failed due to too short: 1003592
reads with adapter trimmed: 117560188
bases trimmed due to adapters: 4535950692

Duplication rate: 23.0681%

Insert size peak (evaluated by paired-end reads): 119

JSON report: GM24385_0001_RNA_0001_23H5VFLT4_s16.fastp.json
HTML report: GM24385_0001_RNA_0001_23H5VFLT4_s16.fastp.html

fastp --in1 GM24385_0001_RNA_0001_23H5VFLT4_s16_1.fastq.gz --in2 GM24385_0001_RNA_0001_23H5VFLT4_s16_2.fastq.gz --out1 GM24385_0001_RNA_0001_23H5VFLT4_s16_1.fastp.fastq.gz --out2 GM24385_0001_RNA_0001_23H5VFLT4_s16_2.fastp.fastq.gz --json GM24385_0001_RNA_0001_23H5VFLT4_s16.fastp.json --html GM24385_0001_RNA_0001_23H5VFLT4_s16.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 208 seconds