Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14833540124(98.2354%)
Q30 bases: 14410451032(95.4335%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14777025448(97.8611%)
Q30 bases: 14194973600(94.0064%)

Read1 after filtering:
total reads: 97887848
total bases: 12768763904
Q20 bases: 12712843472(99.5621%)
Q30 bases: 12501420670(97.9063%)

Read2 after filtering:
total reads: 97887848
total bases: 12780539256
Q20 bases: 12687508874(99.2721%)
Q30 bases: 12411674342(97.1139%)

Filtering result:
reads passed filter: 195775696
reads failed due to low quality: 2747522
reads failed due to too many N: 519238
reads failed due to too short: 957544
reads with adapter trimmed: 110866627
bases trimmed due to adapters: 4071980711

Duplication rate: 23.0344%

Insert size peak (evaluated by paired-end reads): 120

JSON report: V4_0001_RNA_0005_23H5VFLT4_s15.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s15.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s15_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s15_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s15_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s15_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s15.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s15.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 184 seconds