Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14901708874(98.6868%)
Q30 bases: 14530702782(96.2298%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14827665866(98.1965%)
Q30 bases: 14310074576(94.7687%)

Read1 after filtering:
total reads: 98248273
total bases: 13102462892
Q20 bases: 13047763090(99.5825%)
Q30 bases: 12838678389(97.9868%)

Read2 after filtering:
total reads: 98248273
total bases: 13110990924
Q20 bases: 13021792961(99.3197%)
Q30 bases: 12749428011(97.2423%)

Filtering result:
reads passed filter: 196496546
reads failed due to low quality: 2481788
reads failed due to too many N: 546928
reads failed due to too short: 474738
reads with adapter trimmed: 98290430
bases trimmed due to adapters: 3499142389

Duplication rate: 21.5324%

Insert size peak (evaluated by paired-end reads): 128

JSON report: V4_0001_RNA_0005_23H5VFLT4_s11.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s11.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s11_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s11_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s11_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s11_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s11.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s11.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 213 seconds