Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14863702058(98.4351%)
Q30 bases: 14418944221(95.4897%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14770352144(97.8169%)
Q30 bases: 14165757011(93.813%)

Read1 after filtering:
total reads: 97760968
total bases: 12506098251
Q20 bases: 12452002989(99.5674%)
Q30 bases: 12249566149(97.9487%)

Read2 after filtering:
total reads: 97760968
total bases: 12518113979
Q20 bases: 12425985137(99.264%)
Q30 bases: 12154703734(97.0969%)

Filtering result:
reads passed filter: 195521936
reads failed due to low quality: 3021228
reads failed due to too many N: 481770
reads failed due to too short: 975066
reads with adapter trimmed: 117904338
bases trimmed due to adapters: 4566927071

Duplication rate: 23.4118%

Insert size peak (evaluated by paired-end reads): 119

JSON report: V4_0001_RNA_0005_23H5VFLT4_s06.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s06.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s06_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s06_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s06_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s06_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s06.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s06.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 216 seconds