Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14861258377(98.4189%)
Q30 bases: 14451053213(95.7023%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14785913825(97.92%)
Q30 bases: 14206923093(94.0856%)

Read1 after filtering:
total reads: 98025938
total bases: 12732450740
Q20 bases: 12678707291(99.5779%)
Q30 bases: 12477705847(97.9992%)

Read2 after filtering:
total reads: 98025938
total bases: 12744703362
Q20 bases: 12649560303(99.2535%)
Q30 bases: 12369783462(97.0582%)

Filtering result:
reads passed filter: 196051876
reads failed due to low quality: 2772334
reads failed due to too many N: 501134
reads failed due to too short: 674656
reads with adapter trimmed: 112774220
bases trimmed due to adapters: 4181021872

Duplication rate: 23.9804%

Insert size peak (evaluated by paired-end reads): 119

JSON report: V4_0001_RNA_0005_23H5VFLT4_s14.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s14.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s14_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s14_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s14_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s14_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s14.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s14.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 215 seconds