Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14896318366(98.6511%)
Q30 bases: 14488601025(95.951%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14770838633(97.8201%)
Q30 bases: 14171021971(93.8478%)

Read1 after filtering:
total reads: 97878477
total bases: 12711548296
Q20 bases: 12658503949(99.5827%)
Q30 bases: 12459176090(98.0146%)

Read2 after filtering:
total reads: 97878477
total bases: 12722389705
Q20 bases: 12629367793(99.2688%)
Q30 bases: 12351489370(97.0847%)

Filtering result:
reads passed filter: 195756954
reads failed due to low quality: 2828694
reads failed due to too many N: 506584
reads failed due to too short: 907768
reads with adapter trimmed: 110070987
bases trimmed due to adapters: 4184737290

Duplication rate: 23.0624%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s04.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s04.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s04_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s04_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s04_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s04_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s04.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s04.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 210 seconds