Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14841445373(98.2877%)
Q30 bases: 14418861698(95.4892%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14791453654(97.9566%)
Q30 bases: 14204205934(94.0676%)

Read1 after filtering:
total reads: 97929596
total bases: 12785032489
Q20 bases: 12731894507(99.5844%)
Q30 bases: 12528860371(97.9963%)

Read2 after filtering:
total reads: 97929596
total bases: 12797208946
Q20 bases: 12700229397(99.2422%)
Q30 bases: 12411070077(96.9826%)

Filtering result:
reads passed filter: 195859192
reads failed due to low quality: 2624638
reads failed due to too many N: 514462
reads failed due to too short: 1001708
reads with adapter trimmed: 107855281
bases trimmed due to adapters: 4050160378

Duplication rate: 21.3934%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s20.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s20.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s20_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s20_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s20_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s20_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s20.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s20.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 210 seconds