Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14837140096(98.2592%)
Q30 bases: 14418352754(95.4858%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14592912106(96.6418%)
Q30 bases: 13935143981(92.2857%)

Read1 after filtering:
total reads: 97536503
total bases: 12811600003
Q20 bases: 12760252047(99.5992%)
Q30 bases: 12562295672(98.0541%)

Read2 after filtering:
total reads: 97536503
total bases: 12821562920
Q20 bases: 12730077756(99.2865%)
Q30 bases: 12451251673(97.1118%)

Filtering result:
reads passed filter: 195073006
reads failed due to low quality: 2735528
reads failed due to too many N: 517718
reads failed due to too short: 1673748
reads with adapter trimmed: 104358793
bases trimmed due to adapters: 3892218119

Duplication rate: 28.6385%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s35.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s35.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s35_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s35_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s35_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s35_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s35.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s35.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 227 seconds