Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14817915348(98.1319%)
Q30 bases: 14372243835(95.1804%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14779218329(97.8756%)
Q30 bases: 14194330122(94.0022%)

Read1 after filtering:
total reads: 97878697
total bases: 12643817450
Q20 bases: 12588852226(99.5653%)
Q30 bases: 12380005950(97.9135%)

Read2 after filtering:
total reads: 97878697
total bases: 12656667492
Q20 bases: 12564607192(99.2726%)
Q30 bases: 12290928682(97.1103%)

Filtering result:
reads passed filter: 195757394
reads failed due to low quality: 2727234
reads failed due to too many N: 501494
reads failed due to too short: 1013878
reads with adapter trimmed: 113370275
bases trimmed due to adapters: 4320384224

Duplication rate: 22.3658%

Insert size peak (evaluated by paired-end reads): 119

JSON report: V4_0001_RNA_0005_23H5VFLT4_s21.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s21.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s21_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s21_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s21_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s21_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s21.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s21.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 308 seconds