Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14847015283(98.3246%)
Q30 bases: 14433849052(95.5884%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14804019168(98.0399%)
Q30 bases: 14239340086(94.3003%)

Read1 after filtering:
total reads: 98078454
total bases: 12828402200
Q20 bases: 12775627990(99.5886%)
Q30 bases: 12573137776(98.0102%)

Read2 after filtering:
total reads: 98078454
total bases: 12837545198
Q20 bases: 12746604624(99.2916%)
Q30 bases: 12469303563(97.1315%)

Filtering result:
reads passed filter: 196156908
reads failed due to low quality: 2724206
reads failed due to too many N: 514072
reads failed due to too short: 604814
reads with adapter trimmed: 106246645
bases trimmed due to adapters: 4004106033

Duplication rate: 19.3148%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s02.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s02.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s02_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s02_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s02_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s02_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s02.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s02.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 213 seconds