Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14862896849(98.4298%)
Q30 bases: 14459041865(95.7552%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14792062237(97.9607%)
Q30 bases: 14224583763(94.2025%)

Read1 after filtering:
total reads: 98047596
total bases: 12876331924
Q20 bases: 12821074185(99.5709%)
Q30 bases: 12614202453(97.9643%)

Read2 after filtering:
total reads: 98047596
total bases: 12887647827
Q20 bases: 12792776195(99.2639%)
Q30 bases: 12510982891(97.0773%)

Filtering result:
reads passed filter: 196095192
reads failed due to low quality: 2769648
reads failed due to too many N: 521740
reads failed due to too short: 613420
reads with adapter trimmed: 107208886
bases trimmed due to adapters: 3897399493

Duplication rate: 25.5869%

Insert size peak (evaluated by paired-end reads): 119

JSON report: V4_0001_RNA_0005_23H5VFLT4_s13.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s13.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s13_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s13_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s13_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s13_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s13.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s13.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 211 seconds