Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14864190762(98.4383%)
Q30 bases: 14472668665(95.8455%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14796260824(97.9885%)
Q30 bases: 14234700647(94.2695%)

Read1 after filtering:
total reads: 97844592
total bases: 12960416740
Q20 bases: 12909110418(99.6041%)
Q30 bases: 12709568388(98.0645%)

Read2 after filtering:
total reads: 97844592
total bases: 12969771983
Q20 bases: 12876739932(99.2827%)
Q30 bases: 12592355918(97.09%)

Filtering result:
reads passed filter: 195689184
reads failed due to low quality: 2883326
reads failed due to too many N: 526206
reads failed due to too short: 901284
reads with adapter trimmed: 100376081
bases trimmed due to adapters: 3673846827

Duplication rate: 29.3408%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s27.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s27.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s27_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s27_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s27_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s27_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s27.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s27.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 233 seconds