Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14865216185(98.4451%)
Q30 bases: 14474629742(95.8585%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14805435478(98.0492%)
Q30 bases: 14243868129(94.3303%)

Read1 after filtering:
total reads: 98220038
total bases: 13019132034
Q20 bases: 12966657883(99.5969%)
Q30 bases: 12764256999(98.0423%)

Read2 after filtering:
total reads: 98220038
total bases: 13029407347
Q20 bases: 12934424404(99.271%)
Q30 bases: 12646139000(97.0584%)

Filtering result:
reads passed filter: 196440076
reads failed due to low quality: 2505268
reads failed due to too many N: 530050
reads failed due to too short: 524606
reads with adapter trimmed: 99847122
bases trimmed due to adapters: 3658172624

Duplication rate: 21.1108%

Insert size peak (evaluated by paired-end reads): 119

JSON report: V4_0001_RNA_0005_23H5VFLT4_s19.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s19.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s19_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s19_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s19_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s19_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s19.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s19.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 223 seconds