File Info

Filename
NTC_0001_0001_23H5VFLT4_s15.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp0003/B23H5VFLT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/NTC_0001_0001_23H5VFLT4_s15.fastp.log
Size
1.5 KB
Published
Jun 08, 2026 12:01 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 206994
total bases: 31256094
Q20 bases: 26891816(86.037%)
Q30 bases: 20602925(65.9165%)

Read2 before filtering:
total reads: 206994
total bases: 31256094
Q20 bases: 29573386(94.6164%)
Q30 bases: 23955746(76.6434%)

Read1 after filtering:
total reads: 36441
total bases: 2341075
Q20 bases: 2229678(95.2416%)
Q30 bases: 2045946(87.3934%)

Read2 after filtering:
total reads: 36441
total bases: 2412120
Q20 bases: 2353604(97.5741%)
Q30 bases: 2211383(91.678%)

Filtering result:
reads passed filter: 72882
reads failed due to low quality: 13762
reads failed due to too many N: 2
reads failed due to too short: 327342
reads with adapter trimmed: 231627
bases trimmed due to adapters: 12444608

Duplication rate: 43.6114%

Insert size peak (evaluated by paired-end reads): 35

JSON report: NTC_0001_0001_23H5VFLT4_s15.fastp.json
HTML report: NTC_0001_0001_23H5VFLT4_s15.fastp.html

fastp --in1 NTC_0001_0001_23H5VFLT4_s15_1.fastq.gz --in2 NTC_0001_0001_23H5VFLT4_s15_2.fastq.gz --out1 NTC_0001_0001_23H5VFLT4_s15_1.fastp.fastq.gz --out2 NTC_0001_0001_23H5VFLT4_s15_2.fastp.fastq.gz --json NTC_0001_0001_23H5VFLT4_s15.fastp.json --html NTC_0001_0001_23H5VFLT4_s15.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 4 seconds