MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 12:12 UTC based on data in: /tmp/nxf.SZAAJwVJme

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	Total Reads	Expected Distinct	Unique Reads	Frac Antisense	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	RNA contaminated	RNA contamination %	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GM24385_0001_RNA_0001_23H5VFLT4_s08	9999000000	209225167	539679900	0.8787	139.5bp	129.0bp	0.11%	1.25%	0.59%	0.00%	0.21%	3.52%	0.81%	0.00%	6.54	570406030	0.01%	0.64%	207441230	0.69%	0.72%	0.28%	0.28%	143730205	72755921	58098792	27728736	261.93	71.00	0.57%	0.47%	0.98	0.000	No	0.00%				64.3%	81.8%	93.8%	267.4M	38.3%	97.5%	70437.7Mb	570.4M	55.3%	97.8%	60.7%
GM24385_0001_RNA_0001_23H5VFLT4_s08_1																																				139.5bp	86.5%	246.6M												77.8%	54%	151bp	151bp	27%	291.5M
GM24385_0001_RNA_0001_23H5VFLT4_s08_2																																																		77.3%	55%	151bp	151bp	18%	291.5M
GM24385_0001_RNA_0001_23H5VFLT4_s08_trimmed_1																																																		77.8%	55%	127bp	137bp	18%	285.2M	77.8%	55%	127bp	137bp	18%	285.2M
GM24385_0001_RNA_0001_23H5VFLT4_s08_trimmed_2																																																		78.3%	55%	127bp	137bp	9%	285.2M	78.3%	55%	127bp	137bp	9%	285.2M
GM24385_0001_RNA_0001_23H5VFLT4_s16	9999000000	207180981	546994842	0.8945	141.5bp	132.0bp	0.12%	1.23%	0.58%	0.00%	0.22%	3.49%	0.79%	0.00%	6.55	576413436	0.01%	0.64%	207381656	0.69%	0.73%	0.28%	0.27%	143829400	72821699	57923736	27599872	265.75	73.00	0.57%	0.47%	0.98	0.000	No	0.00%				64.7%	82.9%	94.0%	271.0M	39.9%	97.5%	71990.4Mb	576.4M	55.1%	97.7%	58.8%
GM24385_0001_RNA_0001_23H5VFLT4_s16_1																																				141.5bp	86.7%	250.0M												78.0%	54%	151bp	151bp	27%	294.9M
GM24385_0001_RNA_0001_23H5VFLT4_s16_2																																																		77.3%	55%	151bp	151bp	18%	294.9M
GM24385_0001_RNA_0001_23H5VFLT4_s16_trimmed_1																																																		78.0%	54%	128bp	137bp	18%	288.2M	78.0%	54%	128bp	137bp	18%	288.2M
GM24385_0001_RNA_0001_23H5VFLT4_s16_trimmed_2																																																		78.5%	55%	128bp	137bp	9%	288.2M	78.5%	55%	128bp	137bp	9%	288.2M
GM24385_0001_RNA_0001_23H5VFLT4_s24	9999000000	195815702	437755938	0.9069	136.9bp	127.0bp	0.13%	1.24%	0.60%	0.00%	0.24%	3.49%	0.81%	0.00%	6.52	461024502	0.01%	0.61%	180664072	0.70%	0.73%	0.27%	0.27%	126957167	64182411	49147265	23494175	227.70	62.00	0.56%	0.45%	0.98	0.000	No	0.00%				61.4%	83.3%	94.1%	217.0M	36.8%	97.5%	56712.7Mb	461.0M	55.0%	97.6%	62.2%
GM24385_0001_RNA_0001_23H5VFLT4_s24_1																																				136.9bp	86.7%	199.9M												76.9%	54%	151bp	151bp	27%	236.1M
GM24385_0001_RNA_0001_23H5VFLT4_s24_2																																																		75.7%	55%	151bp	151bp	27%	236.1M
GM24385_0001_RNA_0001_23H5VFLT4_s24_trimmed_1																																																		76.9%	54%	126bp	132bp	18%	230.5M	76.9%	54%	126bp	132bp	18%	230.5M
GM24385_0001_RNA_0001_23H5VFLT4_s24_trimmed_2																																																		76.7%	55%	126bp	132bp	9%	230.5M	76.7%	55%	126bp	132bp	9%	230.5M
GM24385_0001_RNA_0001_23H5VFLT4_s32	9999000000	137310685	434303903	0.9244	136.4bp	127.0bp	0.11%	1.22%	0.59%	0.00%	0.20%	3.42%	0.79%	0.00%	6.59	459063162	0.01%	0.72%	129294629	0.59%	0.62%	0.37%	0.38%	76253188	38585497	48420198	23436569	132.71	34.00	0.51%	0.36%	0.98	0.000	No	0.00%				72.6%	81.9%	93.8%	215.4M	43.9%	97.5%	56043.7Mb	459.1M	55.2%	97.3%	63.2%
GM24385_0001_RNA_0001_23H5VFLT4_s32_1																																				136.4bp	85.8%	196.9M												80.0%	54%	151bp	151bp	27%	236.0M
GM24385_0001_RNA_0001_23H5VFLT4_s32_2																																																		78.8%	55%	151bp	151bp	27%	236.0M
GM24385_0001_RNA_0001_23H5VFLT4_s32_trimmed_1																																																		79.9%	55%	125bp	132bp	18%	229.5M	79.9%	55%	125bp	132bp	18%	229.5M
GM24385_0001_RNA_0001_23H5VFLT4_s32_trimmed_2																																																		79.6%	55%	125bp	132bp	9%	229.5M	79.6%	55%	125bp	132bp	9%	229.5M
GM24385_0001_RNA_0001_23H5VFLT4_s40	9999000000	130364108	481983078	0.9328	131.3bp	122.0bp	0.12%	1.27%	0.60%	0.00%	0.21%	3.54%	0.81%	0.00%	6.57	506350638	0.01%	0.76%	123848589	0.54%	0.58%	0.42%	0.42%	67465415	34098086	51639671	25137155	112.97	28.00	0.50%	0.32%	0.98	0.000	No	0.00%				76.3%	84.1%	94.5%	239.2M	44.2%	97.6%	60687.9Mb	506.4M	54.5%	97.4%	66.9%
GM24385_0001_RNA_0001_23H5VFLT4_s40_1																																				131.3bp	86.5%	218.9M												81.8%	53%	151bp	151bp	27%	260.1M
GM24385_0001_RNA_0001_23H5VFLT4_s40_2																																																		80.0%	54%	151bp	151bp	36%	260.1M
GM24385_0001_RNA_0001_23H5VFLT4_s40_trimmed_1																																																		81.7%	54%	123bp	127bp	18%	253.2M	81.7%	54%	123bp	127bp	18%	253.2M
GM24385_0001_RNA_0001_23H5VFLT4_s40_trimmed_2																																																		80.9%	54%	123bp	127bp	9%	253.2M	80.9%	54%	123bp	127bp	9%	253.2M
GM24385_0001_RNA_0001_23H5VFLT4_s48	9999000000	122508015	403498270	0.9403	135.1bp	125.0bp	0.11%	1.24%	0.60%	0.00%	0.20%	3.48%	0.81%	0.00%	6.53	426034914	0.01%	0.74%	112297339	0.58%	0.61%	0.38%	0.39%	65284633	33031199	42812708	20707650	113.09	28.00	0.49%	0.32%	0.98	0.000	No	0.00%				74.4%	82.5%	94.0%	200.1M	45.6%	97.5%	51730.2Mb	426.0M	55.4%	97.3%	63.5%
GM24385_0001_RNA_0001_23H5VFLT4_s48_1																																				135.1bp	86.6%	184.4M												80.8%	54%	151bp	151bp	27%	219.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48_2																																																		78.9%	55%	151bp	151bp	36%	219.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48_trimmed_1																																																		80.7%	55%	124bp	132bp	18%	213.0M	80.7%	55%	124bp	132bp	18%	213.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48_trimmed_2																																																		80.0%	55%	125bp	132bp	9%	213.0M	80.0%	55%	125bp	132bp	9%	213.0M
HD789_0002_RNA_0008_23H5VFLT4_s19	9999000000	426168763	575935933	0.9263	172.7bp	157.0bp	0.11%	1.14%	0.56%	0.00%	0.21%	3.34%	0.80%	0.00%	4.23	593510704	0.00%	0.45%	324089247	0.89%	0.92%	0.10%	0.08%	289839374	147427510	31737137	12787334	645.84	274.00	0.71%	0.62%	0.98	0.000	Yes	63.71%				45.6%	90.0%	96.3%	285.7M	34.6%	97.6%	80285.8Mb	593.5M	54.7%	98.9%	36.8%
HD789_0002_RNA_0008_23H5VFLT4_s19_1																																				172.7bp	94.7%	281.0M												83.3%	54%	151bp	151bp	27%	487.1M
HD789_0002_RNA_0008_23H5VFLT4_s19_2																																																		83.5%	55%	151bp	151bp	18%	487.1M
HD789_0002_RNA_0008_23H5VFLT4_s19_trimmed_1																																																		79.8%	54%	139bp	151bp	18%	296.8M	79.8%	54%	139bp	151bp	18%	296.8M
HD789_0002_RNA_0008_23H5VFLT4_s19_trimmed_2																																																		81.0%	55%	139bp	151bp	9%	296.8M	81.0%	55%	139bp	151bp	9%	296.8M
NTC_0001_0001_23H5VFLT4_s15	9999000000	36700	8272	0.4199	32.9bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	72882	0.35%	0.42%	42135	0.01%	0.02%	0.39%	0.98%	424	191	16275	7903	0.00	0.00	0.00%	0.00%	0.92	0.000	Skipped	N/A%				64.8%	1.8%	9.2%	0.0M	43.6%	89.6%	4.3Mb	0.1M	67.9%	17.6%	56.0%
NTC_0001_0001_23H5VFLT4_s15_1																																				32.9bp	3.3%	0.0M												89.4%	73%	151bp	151bp	55%	0.2M
NTC_0001_0001_23H5VFLT4_s15_2																																																		88.1%	93%	151bp	151bp	55%	0.2M
NTC_0001_0001_23H5VFLT4_s15_trimmed_1																																																		51.0%	65%	64bp	37bp	36%	0.0M	51.0%	65%	64bp	37bp	36%	0.0M
NTC_0001_0001_23H5VFLT4_s15_trimmed_2																																																		53.1%	70%	66bp	37bp	45%	0.0M	53.1%	70%	66bp	37bp	45%	0.0M
V4_0001_RNA_0001_23H5VFLT4_s13	9999000000	347933411	574613991	0.9249	161.2bp	148.0bp	0.10%	1.16%	0.99%	0.00%	0.19%	3.20%	1.35%	0.00%	6.65	593573578	0.01%	0.51%	292968423	0.87%	0.90%	0.12%	0.10%	255713682	129846867	34193723	14611163	541.45	133.00	0.60%	0.52%	0.98	0.000	No	0.00%				50.9%	89.3%	95.9%	284.6M	36.4%	97.7%	79039.8Mb	593.6M	54.6%	98.9%	43.3%
V4_0001_RNA_0001_23H5VFLT4_s13_1																																				161.2bp	93.3%	276.9M												81.7%	54%	151bp	151bp	27%	381.8M
V4_0001_RNA_0001_23H5VFLT4_s13_2																																																		81.8%	54%	151bp	151bp	18%	381.8M
V4_0001_RNA_0001_23H5VFLT4_s13_trimmed_1																																																		79.8%	54%	136bp	151bp	18%	296.8M	79.8%	54%	136bp	151bp	18%	296.8M
V4_0001_RNA_0001_23H5VFLT4_s13_trimmed_2																																																		80.9%	54%	136bp	151bp	9%	296.8M	80.9%	54%	136bp	151bp	9%	296.8M
V4_0001_RNA_0005_23H5VFLT4_s01	9999000000	283703214	562894561	0.8916	153.0bp	140.0bp	0.14%	1.09%	0.78%	0.00%	0.26%	3.03%	1.02%	0.00%	6.53	588008828	0.01%	0.55%	266016748	0.81%	0.84%	0.17%	0.16%	215862770	109500070	46238926	20990279	436.18	110.00	0.59%	0.51%	0.98	0.000	No	0.00%				55.1%	85.4%	94.8%	278.8M	33.9%	97.5%	76007.7Mb	588.0M	55.0%	98.0%	49.6%
V4_0001_RNA_0005_23H5VFLT4_s01_1																																				153.0bp	90.1%	265.0M												80.5%	54%	151bp	151bp	27%	388.2M
V4_0001_RNA_0005_23H5VFLT4_s01_2																																																		80.2%	55%	151bp	151bp	18%	388.2M
V4_0001_RNA_0005_23H5VFLT4_s01_trimmed_1																																																		78.3%	54%	133bp	151bp	18%	294.0M	78.3%	54%	133bp	151bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s01_trimmed_2																																																		79.0%	55%	133bp	151bp	18%	294.0M	79.0%	55%	133bp	151bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s02	9990000000	258952157	563315639	0.8787	148.4bp	135.0bp	0.14%	1.13%	0.75%	0.00%	0.27%	3.15%	0.98%	0.00%	6.54	588194630	0.01%	0.58%	246711433	0.78%	0.81%	0.20%	0.19%	193543706	98073760	48991766	22674271	379.64	100.00	0.58%	0.50%	0.98	0.000	No	0.00%				58.5%	85.6%	94.9%	279.0M	36.1%	97.5%	75058.5Mb	588.2M	54.6%	98.0%	53.2%
V4_0001_RNA_0005_23H5VFLT4_s02_1																																				148.4bp	89.7%	263.9M												79.3%	53%	151bp	151bp	27%	343.4M
V4_0001_RNA_0005_23H5VFLT4_s02_2																																																		78.9%	54%	151bp	151bp	18%	343.4M
V4_0001_RNA_0005_23H5VFLT4_s02_trimmed_1																																																		78.1%	54%	131bp	147bp	18%	294.1M	78.1%	54%	131bp	147bp	18%	294.1M
V4_0001_RNA_0005_23H5VFLT4_s02_trimmed_2																																																		78.7%	54%	131bp	147bp	18%	294.1M	78.7%	54%	131bp	147bp	18%	294.1M
V4_0001_RNA_0005_23H5VFLT4_s03	9999000000	232321480	561400928	0.8761	148.4bp	137.0bp	0.12%	1.16%	0.69%	0.00%	0.23%	3.27%	0.91%	0.00%	6.58	587994234	0.01%	0.61%	229208797	0.76%	0.79%	0.22%	0.21%	174186296	88323306	50527620	23548117	340.41	91.00	0.58%	0.49%	0.98	0.000	No	0.00%				61.5%	84.5%	94.6%	278.1M	38.5%	97.5%	75108.2Mb	588.0M	54.9%	98.0%	53.2%
V4_0001_RNA_0005_23H5VFLT4_s03_1																																				148.4bp	89.0%	261.7M												80.4%	54%	151bp	151bp	27%	369.1M
V4_0001_RNA_0005_23H5VFLT4_s03_2																																																		79.8%	55%	151bp	151bp	18%	369.1M
V4_0001_RNA_0005_23H5VFLT4_s03_trimmed_1																																																		78.6%	54%	131bp	147bp	18%	294.0M	78.6%	54%	131bp	147bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s03_trimmed_2																																																		79.0%	55%	131bp	147bp	18%	294.0M	79.0%	55%	131bp	147bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s04	9999000000	214182941	559487770	0.8857	145.7bp	135.0bp	0.12%	1.19%	0.65%	0.00%	0.22%	3.35%	0.87%	0.00%	6.58	587200532	0.01%	0.64%	214257858	0.73%	0.76%	0.25%	0.24%	155937014	79033254	53379712	25157494	298.27	80.00	0.57%	0.48%	0.98	0.000	No	0.00%				64.1%	84.0%	94.4%	277.1M	40.8%	97.5%	74414.4Mb	587.2M	55.0%	97.9%	55.0%
V4_0001_RNA_0005_23H5VFLT4_s04_1																																				145.7bp	88.1%	258.7M												79.1%	54%	151bp	151bp	27%	311.3M
V4_0001_RNA_0005_23H5VFLT4_s04_2																																																		78.2%	55%	151bp	151bp	18%	311.3M
V4_0001_RNA_0005_23H5VFLT4_s04_trimmed_1																																																		78.7%	54%	130bp	142bp	18%	293.6M	78.7%	54%	130bp	142bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s04_trimmed_2																																																		78.9%	55%	130bp	142bp	9%	293.6M	78.9%	55%	130bp	142bp	9%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s05	9999000000	207621562	555856248	0.8753	140.8bp	131.0bp	0.11%	1.22%	0.63%	0.00%	0.20%	3.42%	0.85%	0.00%	6.56	586364364	0.01%	0.64%	209115004	0.71%	0.74%	0.26%	0.26%	148763124	75331503	54912870	26075142	275.12	74.00	0.57%	0.47%	0.98	0.000	No	0.00%				64.9%	82.1%	93.9%	275.4M	40.6%	97.5%	72938.9Mb	586.4M	55.5%	97.7%	59.3%
V4_0001_RNA_0005_23H5VFLT4_s05_1																																				140.8bp	87.5%	256.7M												78.5%	54%	151bp	151bp	27%	302.0M
V4_0001_RNA_0005_23H5VFLT4_s05_2																																																		77.9%	55%	151bp	151bp	27%	302.0M
V4_0001_RNA_0005_23H5VFLT4_s05_trimmed_1																																																		78.5%	55%	128bp	137bp	18%	293.2M	78.5%	55%	128bp	137bp	18%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s05_trimmed_2																																																		78.9%	55%	128bp	137bp	9%	293.2M	78.9%	55%	128bp	137bp	9%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s06	9999000000	205256196	557180753	0.8773	141.6bp	131.0bp	0.11%	1.23%	0.61%	0.00%	0.20%	3.46%	0.82%	0.00%	6.55	586490874	0.01%	0.65%	206672555	0.70%	0.73%	0.27%	0.27%	145429611	73640049	55891897	26581664	268.56	73.00	0.57%	0.47%	0.98	0.000	No	0.00%				65.4%	82.9%	94.1%	276.0M	40.8%	97.5%	73191.3Mb	586.5M	55.2%	97.7%	59.0%
V4_0001_RNA_0005_23H5VFLT4_s06_1																																				141.6bp	87.4%	256.4M												78.8%	54%	151bp	151bp	27%	312.8M
V4_0001_RNA_0005_23H5VFLT4_s06_2																																																		78.2%	55%	151bp	151bp	18%	312.8M
V4_0001_RNA_0005_23H5VFLT4_s06_trimmed_1																																																		78.4%	55%	128bp	137bp	18%	293.2M	78.4%	55%	128bp	137bp	18%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s06_trimmed_2																																																		78.9%	55%	128bp	137bp	9%	293.2M	78.9%	55%	128bp	137bp	9%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s07	9999000000	180516629	476872033	0.8727	138.9bp	130.0bp	0.12%	1.20%	0.59%	0.00%	0.22%	3.36%	0.80%	0.00%	6.54	507719532	0.01%	0.66%	172336511	0.66%	0.69%	0.31%	0.31%	113136719	57291297	53638444	25704926	205.02	54.00	0.55%	0.43%	0.98	0.000	No	0.00%				66.8%	79.6%	93.1%	236.3M	40.3%	97.4%	62803.5Mb	507.7M	56.0%	97.5%	60.5%
V4_0001_RNA_0005_23H5VFLT4_s07_1																																				138.9bp	85.3%	216.5M												77.8%	55%	151bp	151bp	27%	260.4M
V4_0001_RNA_0005_23H5VFLT4_s07_2																																																		76.9%	56%	151bp	151bp	27%	260.4M
V4_0001_RNA_0005_23H5VFLT4_s07_trimmed_1																																																		77.8%	55%	127bp	137bp	18%	253.9M	77.8%	55%	127bp	137bp	18%	253.9M
V4_0001_RNA_0005_23H5VFLT4_s07_trimmed_2																																																		78.0%	56%	127bp	137bp	9%	253.9M	78.0%	56%	127bp	137bp	9%	253.9M
V4_0001_RNA_0005_23H5VFLT4_s09	9999000000	310972687	567846214	0.9158	157.2bp	144.0bp	0.15%	1.09%	0.78%	0.00%	0.28%	3.06%	1.01%	0.00%	6.59	589592316	0.01%	0.53%	278426127	0.82%	0.85%	0.17%	0.15%	228503660	115974735	46412411	20955219	471.65	124.00	0.59%	0.52%	0.98	0.000	No	0.00%				53.1%	87.6%	95.5%	281.5M	34.0%	97.6%	77077.0Mb	589.6M	54.0%	98.3%	47.2%
V4_0001_RNA_0005_23H5VFLT4_s09_1																																				157.2bp	90.7%	267.5M												79.8%	53%	151bp	151bp	27%	358.3M
V4_0001_RNA_0005_23H5VFLT4_s09_2																																																		79.4%	54%	151bp	151bp	18%	358.3M
V4_0001_RNA_0005_23H5VFLT4_s09_trimmed_1																																																		78.4%	53%	134bp	151bp	18%	294.8M	78.4%	53%	134bp	151bp	18%	294.8M
V4_0001_RNA_0005_23H5VFLT4_s09_trimmed_2																																																		79.1%	54%	134bp	151bp	18%	294.8M	79.1%	54%	134bp	151bp	18%	294.8M
V4_0001_RNA_0005_23H5VFLT4_s10	9999000000	265731070	565734428	0.9138	153.9bp	141.0bp	0.14%	1.11%	0.74%	0.00%	0.26%	3.14%	0.96%	0.00%	6.59	588800886	0.01%	0.57%	255508397	0.80%	0.83%	0.19%	0.17%	203823377	103389788	47787095	21902536	412.53	110.00	0.59%	0.51%	0.98	0.000	No	0.00%				57.0%	86.9%	95.2%	280.4M	37.2%	97.6%	76599.2Mb	588.8M	54.3%	98.1%	49.0%
V4_0001_RNA_0005_23H5VFLT4_s10_1																																				153.9bp	90.1%	265.3M												79.8%	53%	151bp	151bp	27%	356.2M
V4_0001_RNA_0005_23H5VFLT4_s10_2																																																		79.6%	54%	151bp	151bp	18%	356.2M
V4_0001_RNA_0005_23H5VFLT4_s10_trimmed_1																																																		78.4%	54%	133bp	151bp	18%	294.4M	78.4%	54%	133bp	151bp	18%	294.4M
V4_0001_RNA_0005_23H5VFLT4_s10_trimmed_2																																																		79.2%	54%	133bp	151bp	18%	294.4M	79.2%	54%	133bp	151bp	18%	294.4M
V4_0001_RNA_0005_23H5VFLT4_s11	9999000000	244468500	540094013	0.9038	154.9bp	143.0bp	0.13%	1.13%	0.68%	0.00%	0.24%	3.22%	0.90%	0.00%	6.62	563578038	0.01%	0.58%	234300774	0.77%	0.80%	0.21%	0.20%	180130022	91415193	50048469	23211004	361.60	99.00	0.58%	0.50%	0.98	0.000	No	0.00%				58.9%	85.9%	95.0%	267.6M	38.8%	97.6%	73390.1Mb	563.6M	54.3%	98.2%	49.1%
V4_0001_RNA_0005_23H5VFLT4_s11_1																																				154.9bp	88.9%	250.5M												77.7%	53%	151bp	151bp	27%	286.8M
V4_0001_RNA_0005_23H5VFLT4_s11_2																																																		77.5%	54%	151bp	151bp	18%	286.8M
V4_0001_RNA_0005_23H5VFLT4_s11_trimmed_1																																																		77.8%	54%	133bp	151bp	18%	281.8M	77.8%	54%	133bp	151bp	18%	281.8M
V4_0001_RNA_0005_23H5VFLT4_s11_trimmed_2																																																		78.4%	54%	133bp	151bp	9%	281.8M	78.4%	54%	133bp	151bp	9%	281.8M
V4_0001_RNA_0005_23H5VFLT4_s12	9999000000	228764667	559525426	0.8902	146.8bp	135.0bp	0.12%	1.19%	0.65%	0.00%	0.23%	3.36%	0.87%	0.00%	6.58	587222856	0.01%	0.62%	225237098	0.73%	0.76%	0.24%	0.24%	165133164	83702202	55129542	25978911	315.78	86.00	0.58%	0.49%	0.98	0.000	No	0.00%				62.2%	84.2%	94.5%	277.3M	37.9%	97.4%	74399.9Mb	587.2M	54.8%	97.9%	55.2%
V4_0001_RNA_0005_23H5VFLT4_s12_1																																				146.8bp	87.9%	258.1M												80.6%	54%	151bp	151bp	27%	384.6M
V4_0001_RNA_0005_23H5VFLT4_s12_2																																																		80.0%	55%	151bp	151bp	18%	384.6M
V4_0001_RNA_0005_23H5VFLT4_s12_trimmed_1																																																		78.4%	54%	130bp	142bp	18%	293.6M	78.4%	54%	130bp	142bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s12_trimmed_2																																																		79.0%	55%	130bp	142bp	18%	293.6M	79.0%	55%	130bp	142bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s13	9999000000	197733844	560909675	0.9095	147.6bp	137.0bp	0.11%	1.17%	0.61%	0.00%	0.21%	3.34%	0.82%	0.00%	6.61	588050104	0.01%	0.67%	196478930	0.70%	0.73%	0.28%	0.27%	136971984	69460619	54385955	25783194	261.56	70.00	0.56%	0.47%	0.98	0.000	No	0.00%				67.2%	84.6%	94.5%	278.0M	43.1%	97.5%	75316.4Mb	588.1M	54.9%	98.0%	53.6%
V4_0001_RNA_0005_23H5VFLT4_s13_1																																				147.6bp	87.8%	258.2M												80.6%	54%	151bp	151bp	27%	337.9M
V4_0001_RNA_0005_23H5VFLT4_s13_2																																																		79.8%	55%	151bp	151bp	18%	337.9M
V4_0001_RNA_0005_23H5VFLT4_s13_trimmed_1																																																		79.5%	54%	131bp	147bp	18%	294.0M	79.5%	54%	131bp	147bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s13_trimmed_2																																																		79.9%	55%	131bp	147bp	18%	294.0M	79.9%	55%	131bp	147bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s14	9990000000	207891860	560289265	0.8932	143.9bp	134.0bp	0.11%	1.20%	0.60%	0.00%	0.21%	3.42%	0.81%	0.00%	6.63	588088650	0.01%	0.65%	205870266	0.70%	0.73%	0.27%	0.27%	144767436	73338616	55824683	26519447	271.40	74.00	0.57%	0.47%	0.98	0.000	No	0.00%				65.6%	84.0%	94.4%	277.6M	41.5%	97.5%	74525.2Mb	588.1M	54.9%	98.0%	56.4%
V4_0001_RNA_0005_23H5VFLT4_s14_1																																				143.9bp	87.7%	257.8M												78.9%	54%	151bp	151bp	27%	311.1M
V4_0001_RNA_0005_23H5VFLT4_s14_2																																																		78.2%	55%	151bp	151bp	18%	311.1M
V4_0001_RNA_0005_23H5VFLT4_s14_trimmed_1																																																		78.7%	54%	130bp	142bp	18%	294.0M	78.7%	54%	130bp	142bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s14_trimmed_2																																																		79.0%	55%	130bp	142bp	9%	294.0M	79.0%	55%	130bp	142bp	9%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s15	9999000000	208640613	527867380	0.8944	145.6bp	135.0bp	0.11%	1.21%	0.58%	0.00%	0.21%	3.44%	0.80%	0.00%	6.61	554380956	0.01%	0.62%	207967984	0.71%	0.74%	0.27%	0.26%	147830378	74918055	55125659	26146602	280.45	78.00	0.57%	0.48%	0.98	0.000	No	0.00%				63.1%	84.0%	94.4%	261.6M	39.5%	97.5%	70548.6Mb	554.4M	54.9%	97.9%	55.4%
V4_0001_RNA_0005_23H5VFLT4_s15_1																																				145.6bp	87.0%	241.2M												77.5%	54%	151bp	151bp	27%	283.2M
V4_0001_RNA_0005_23H5VFLT4_s15_2																																																		77.1%	55%	151bp	151bp	18%	283.2M
V4_0001_RNA_0005_23H5VFLT4_s15_trimmed_1																																																		77.5%	54%	130bp	142bp	18%	277.2M	77.5%	54%	130bp	142bp	18%	277.2M
V4_0001_RNA_0005_23H5VFLT4_s15_trimmed_2																																																		78.0%	55%	131bp	142bp	9%	277.2M	78.0%	55%	131bp	142bp	9%	277.2M
V4_0001_RNA_0005_23H5VFLT4_s17	9999000000	309737773	568206963	0.9265	155.2bp	142.0bp	0.16%	1.08%	0.77%	0.00%	0.30%	3.06%	1.00%	0.00%	6.62	589211620	0.01%	0.53%	279812829	0.82%	0.85%	0.16%	0.15%	230543319	116964941	45843901	20683239	474.32	126.00	0.59%	0.52%	0.98	0.000	No	0.00%				52.8%	88.0%	95.6%	281.6M	34.7%	97.6%	76978.0Mb	589.2M	53.7%	98.2%	46.8%
V4_0001_RNA_0005_23H5VFLT4_s17_1																																				155.2bp	90.9%	267.8M												81.7%	53%	151bp	151bp	27%	444.0M
V4_0001_RNA_0005_23H5VFLT4_s17_2																																																		81.4%	54%	151bp	151bp	18%	444.0M
V4_0001_RNA_0005_23H5VFLT4_s17_trimmed_1																																																		78.6%	53%	134bp	151bp	27%	294.6M	78.6%	53%	134bp	151bp	27%	294.6M
V4_0001_RNA_0005_23H5VFLT4_s17_trimmed_2																																																		79.5%	54%	134bp	151bp	18%	294.6M	79.5%	54%	134bp	151bp	18%	294.6M
V4_0001_RNA_0005_23H5VFLT4_s18	9999000000	274529935	563763224	0.9202	152.7bp	140.0bp	0.14%	1.12%	0.74%	0.00%	0.27%	3.16%	0.96%	0.00%	6.58	587289424	0.01%	0.56%	259480277	0.80%	0.83%	0.19%	0.17%	207009947	104977886	48475782	22201539	416.85	112.00	0.59%	0.51%	0.98	0.000	No	0.00%				56.2%	86.4%	95.1%	279.3M	35.6%	97.5%	76006.1Mb	587.3M	54.2%	97.9%	49.7%
V4_0001_RNA_0005_23H5VFLT4_s18_1																																				152.7bp	89.9%	264.1M												79.6%	53%	151bp	151bp	27%	350.2M
V4_0001_RNA_0005_23H5VFLT4_s18_2																																																		79.2%	54%	151bp	151bp	18%	350.2M
V4_0001_RNA_0005_23H5VFLT4_s18_trimmed_1																																																		78.3%	53%	133bp	151bp	18%	293.6M	78.3%	53%	133bp	151bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s18_trimmed_2																																																		79.0%	54%	133bp	151bp	18%	293.6M	79.0%	54%	133bp	151bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s19	9999000000	238864638	563730049	0.9243	152.0bp	140.0bp	0.13%	1.14%	0.68%	0.00%	0.25%	3.26%	0.90%	0.00%	6.65	589000052	0.01%	0.60%	235733539	0.76%	0.79%	0.22%	0.21%	178484114	90584071	52746611	24539180	356.67	98.00	0.58%	0.50%	0.98	0.000	No	0.00%				60.4%	85.6%	94.9%	279.4M	38.4%	97.5%	76132.4Mb	589.0M	54.2%	98.2%	50.0%
V4_0001_RNA_0005_23H5VFLT4_s19_1																																				152.0bp	88.6%	261.0M												80.1%	53%	151bp	151bp	27%	353.8M
V4_0001_RNA_0005_23H5VFLT4_s19_2																																																		79.6%	54%	151bp	151bp	18%	353.8M
V4_0001_RNA_0005_23H5VFLT4_s19_trimmed_1																																																		78.7%	53%	132bp	151bp	18%	294.5M	78.7%	53%	132bp	151bp	18%	294.5M
V4_0001_RNA_0005_23H5VFLT4_s19_trimmed_2																																																		79.1%	54%	133bp	151bp	18%	294.5M	79.1%	54%	133bp	151bp	18%	294.5M
V4_0001_RNA_0005_23H5VFLT4_s20	9999000000	234118791	559396069	0.9131	148.7bp	137.0bp	0.13%	1.18%	0.65%	0.00%	0.24%	3.35%	0.86%	0.00%	6.64	587464140	0.01%	0.61%	230391829	0.74%	0.77%	0.24%	0.23%	170521507	86444195	54879045	25780644	329.57	91.00	0.58%	0.49%	0.98	0.000	No	0.00%				61.3%	83.8%	94.4%	277.3M	38.6%	97.5%	74793.6Mb	587.5M	54.6%	97.9%	53.9%
V4_0001_RNA_0005_23H5VFLT4_s20_1																																				148.7bp	87.9%	258.1M												79.0%	54%	151bp	151bp	27%	320.4M
V4_0001_RNA_0005_23H5VFLT4_s20_2																																																		78.4%	54%	151bp	151bp	18%	320.4M
V4_0001_RNA_0005_23H5VFLT4_s20_trimmed_1																																																		78.4%	54%	131bp	142bp	18%	293.7M	78.4%	54%	131bp	142bp	18%	293.7M
V4_0001_RNA_0005_23H5VFLT4_s20_trimmed_2																																																		78.8%	54%	131bp	147bp	18%	293.7M	78.8%	54%	131bp	147bp	18%	293.7M
V4_0001_RNA_0005_23H5VFLT4_s21	9999000000	219633877	554695986	0.8986	144.8bp	134.0bp	0.12%	1.21%	0.62%	0.00%	0.22%	3.43%	0.83%	0.00%	6.60	583490244	0.01%	0.63%	216307678	0.72%	0.75%	0.26%	0.25%	155216871	78632167	55876749	26444682	292.79	80.00	0.57%	0.48%	0.98	0.000	No	0.00%				63.5%	83.0%	94.2%	274.8M	39.5%	97.5%	73538.9Mb	583.5M	54.8%	97.9%	56.7%
V4_0001_RNA_0005_23H5VFLT4_s21_1																																				144.8bp	87.6%	255.7M												78.4%	54%	151bp	151bp	27%	298.1M
V4_0001_RNA_0005_23H5VFLT4_s21_2																																																		77.8%	55%	151bp	151bp	18%	298.1M
V4_0001_RNA_0005_23H5VFLT4_s21_trimmed_1																																																		78.4%	54%	129bp	142bp	18%	291.7M	78.4%	54%	129bp	142bp	18%	291.7M
V4_0001_RNA_0005_23H5VFLT4_s21_trimmed_2																																																		78.8%	55%	129bp	142bp	9%	291.7M	78.8%	55%	129bp	142bp	9%	291.7M
V4_0001_RNA_0005_23H5VFLT4_s22	9999000000	204485400	485838686	0.9023	144.3bp	133.0bp	0.12%	1.21%	0.60%	0.00%	0.23%	3.43%	0.82%	0.00%	6.62	510436288	0.01%	0.61%	200162836	0.72%	0.75%	0.25%	0.25%	144571781	73229481	50932341	24102397	273.51	76.00	0.57%	0.47%	0.98	0.000	No	0.00%				61.3%	83.8%	94.3%	240.7M	38.1%	97.5%	64486.7Mb	510.4M	54.7%	97.9%	56.2%
V4_0001_RNA_0005_23H5VFLT4_s22_1																																				144.3bp	87.2%	222.7M												77.1%	54%	151bp	151bp	27%	260.6M
V4_0001_RNA_0005_23H5VFLT4_s22_2																																																		76.2%	54%	151bp	151bp	18%	260.6M
V4_0001_RNA_0005_23H5VFLT4_s22_trimmed_1																																																		77.1%	54%	129bp	142bp	18%	255.2M	77.1%	54%	129bp	142bp	18%	255.2M
V4_0001_RNA_0005_23H5VFLT4_s22_trimmed_2																																																		77.3%	54%	130bp	142bp	9%	255.2M	77.3%	54%	130bp	142bp	9%	255.2M
V4_0001_RNA_0005_23H5VFLT4_s23	9999000000	176618396	543374258	0.8932	143.4bp	134.0bp	0.12%	1.23%	0.59%	0.00%	0.22%	3.50%	0.80%	0.00%	6.62	572221808	0.01%	0.68%	184586834	0.67%	0.70%	0.30%	0.30%	123892948	62779086	55285023	26385636	231.87	62.00	0.56%	0.45%	0.98	0.000	No	0.00%				68.4%	83.1%	94.1%	269.3M	43.2%	97.5%	72012.7Mb	572.2M	54.9%	97.9%	57.0%
V4_0001_RNA_0005_23H5VFLT4_s23_1																																				143.4bp	86.9%	248.5M												79.3%	54%	151bp	151bp	27%	292.3M
V4_0001_RNA_0005_23H5VFLT4_s23_2																																																		78.5%	55%	151bp	151bp	18%	292.3M
V4_0001_RNA_0005_23H5VFLT4_s23_trimmed_1																																																		79.4%	54%	129bp	142bp	18%	286.1M	79.4%	54%	129bp	142bp	18%	286.1M
V4_0001_RNA_0005_23H5VFLT4_s23_trimmed_2																																																		79.5%	55%	129bp	142bp	9%	286.1M	79.5%	55%	129bp	142bp	9%	286.1M
V4_0001_RNA_0005_23H5VFLT4_s25	9999000000	232695553	565849545	0.9339	154.5bp	141.0bp	0.13%	1.07%	0.79%	0.00%	0.24%	3.00%	1.02%	0.00%	6.54	588096022	0.01%	0.62%	224790062	0.79%	0.82%	0.19%	0.18%	177820859	90242237	43408008	19878967	355.50	86.00	0.57%	0.49%	0.98	0.000	No	0.00%				62.2%	87.3%	95.4%	280.6M	39.3%	97.5%	76035.7Mb	588.1M	54.6%	98.0%	49.7%
V4_0001_RNA_0005_23H5VFLT4_s25_1																																				154.5bp	91.0%	267.6M												83.3%	53%	151bp	151bp	27%	433.1M
V4_0001_RNA_0005_23H5VFLT4_s25_2																																																		82.5%	54%	151bp	151bp	18%	433.1M
V4_0001_RNA_0005_23H5VFLT4_s25_trimmed_1																																																		80.5%	54%	133bp	151bp	27%	294.0M	80.5%	54%	133bp	151bp	27%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s25_trimmed_2																																																		80.8%	54%	133bp	151bp	18%	294.0M	80.8%	54%	133bp	151bp	18%	294.0M
V4_0001_RNA_0005_23H5VFLT4_s26	9999000000	206133045	561279499	0.9273	155.4bp	142.0bp	0.13%	1.09%	0.72%	0.00%	0.23%	3.10%	0.95%	0.00%	6.62	584747800	0.01%	0.64%	210357879	0.76%	0.79%	0.22%	0.21%	159510644	80950751	46811096	21646927	319.63	81.00	0.57%	0.48%	0.98	0.000	No	0.00%				64.5%	86.5%	95.1%	278.1M	40.6%	97.5%	75738.2Mb	584.7M	54.1%	97.5%	48.8%
V4_0001_RNA_0005_23H5VFLT4_s26_1																																				155.4bp	89.8%	262.6M												82.7%	53%	151bp	151bp	27%	409.4M
V4_0001_RNA_0005_23H5VFLT4_s26_2																																																		81.9%	54%	151bp	151bp	18%	409.4M
V4_0001_RNA_0005_23H5VFLT4_s26_trimmed_1																																																		80.0%	53%	133bp	151bp	27%	292.4M	80.0%	53%	133bp	151bp	27%	292.4M
V4_0001_RNA_0005_23H5VFLT4_s26_trimmed_2																																																		80.5%	54%	133bp	151bp	18%	292.4M	80.5%	54%	133bp	151bp	18%	292.4M
V4_0001_RNA_0005_23H5VFLT4_s27	9999000000	166406661	561912082	0.9290	153.3bp	140.0bp	0.12%	1.13%	0.68%	0.00%	0.22%	3.21%	0.90%	0.00%	6.66	586743728	0.01%	0.71%	171394599	0.69%	0.72%	0.29%	0.28%	117556152	59685701	49462496	23332695	229.82	58.00	0.55%	0.45%	0.98	0.000	No	0.00%				71.3%	85.8%	94.9%	278.5M	46.6%	97.5%	75805.2Mb	586.7M	54.1%	97.8%	50.3%
V4_0001_RNA_0005_23H5VFLT4_s27_1																																				153.3bp	88.7%	260.2M												82.5%	53%	151bp	151bp	27%	350.5M
V4_0001_RNA_0005_23H5VFLT4_s27_2																																																		81.6%	54%	151bp	151bp	18%	350.5M
V4_0001_RNA_0005_23H5VFLT4_s27_trimmed_1																																																		81.3%	53%	132bp	147bp	18%	293.4M	81.3%	53%	132bp	147bp	18%	293.4M
V4_0001_RNA_0005_23H5VFLT4_s27_trimmed_2																																																		81.5%	54%	132bp	151bp	18%	293.4M	81.5%	54%	132bp	151bp	18%	293.4M
V4_0001_RNA_0005_23H5VFLT4_s28	9999000000	149945740	447945969	0.9289	147.1bp	135.0bp	0.12%	1.15%	0.64%	0.00%	0.22%	3.26%	0.87%	0.00%	6.62	469911882	0.01%	0.68%	149957019	0.69%	0.72%	0.29%	0.28%	102995136	52233573	43070207	20439159	195.78	50.00	0.54%	0.43%	0.98	0.000	No	0.00%				68.7%	84.1%	94.5%	222.1M	44.4%	97.5%	59744.7Mb	469.9M	54.5%	97.6%	53.9%
V4_0001_RNA_0005_23H5VFLT4_s28_1																																				147.1bp	87.9%	206.4M												79.5%	54%	151bp	151bp	27%	240.7M
V4_0001_RNA_0005_23H5VFLT4_s28_2																																																		78.3%	54%	151bp	151bp	27%	240.7M
V4_0001_RNA_0005_23H5VFLT4_s28_trimmed_1																																																		79.5%	54%	130bp	142bp	18%	235.0M	79.5%	54%	130bp	142bp	18%	235.0M
V4_0001_RNA_0005_23H5VFLT4_s28_trimmed_2																																																		79.4%	54%	130bp	142bp	9%	235.0M	79.4%	54%	130bp	142bp	9%	235.0M
V4_0001_RNA_0005_23H5VFLT4_s29	9999000000	158926285	559062264	0.9083	143.0bp	132.0bp	0.11%	1.19%	0.62%	0.00%	0.20%	3.37%	0.83%	0.00%	6.66	585178040	0.01%	0.73%	158213641	0.62%	0.65%	0.35%	0.35%	98088105	49709980	55211846	26541397	180.02	46.00	0.54%	0.41%	0.98	0.000	No	0.00%				73.6%	85.2%	94.7%	277.1M	47.7%	97.6%	73639.6Mb	585.2M	54.4%	97.5%	57.4%
V4_0001_RNA_0005_23H5VFLT4_s29_1																																				143.0bp	87.4%	255.7M												81.9%	54%	151bp	151bp	27%	320.0M
V4_0001_RNA_0005_23H5VFLT4_s29_2																																																		80.7%	54%	151bp	151bp	27%	320.0M
V4_0001_RNA_0005_23H5VFLT4_s29_trimmed_1																																																		81.3%	54%	129bp	142bp	18%	292.6M	81.3%	54%	129bp	142bp	18%	292.6M
V4_0001_RNA_0005_23H5VFLT4_s29_trimmed_2																																																		81.1%	54%	129bp	142bp	18%	292.6M	81.1%	54%	129bp	142bp	18%	292.6M
V4_0001_RNA_0005_23H5VFLT4_s30	9999000000	147380601	457813873	0.9232	143.7bp	134.0bp	0.11%	1.22%	0.60%	0.00%	0.20%	3.47%	0.82%	0.00%	6.65	481215060	0.01%	0.69%	148616118	0.65%	0.68%	0.32%	0.32%	96918597	49120254	47359305	22677467	179.42	47.00	0.54%	0.41%	0.98	0.000	No	0.00%				69.7%	83.6%	94.3%	227.0M	44.7%	97.5%	60239.6Mb	481.2M	54.6%	97.2%	57.4%
V4_0001_RNA_0005_23H5VFLT4_s30_1																																				143.7bp	86.8%	208.8M												79.2%	54%	151bp	151bp	36%	247.7M
V4_0001_RNA_0005_23H5VFLT4_s30_2																																																		78.1%	55%	151bp	151bp	27%	247.7M
V4_0001_RNA_0005_23H5VFLT4_s30_trimmed_1																																																		79.1%	54%	128bp	137bp	18%	240.6M	79.1%	54%	128bp	137bp	18%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s30_trimmed_2																																																		79.0%	54%	128bp	142bp	9%	240.6M	79.0%	54%	128bp	142bp	9%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s31	9999000000	135710593	557527280	0.9091	142.4bp	132.0bp	0.09%	1.19%	0.58%	0.00%	0.16%	3.37%	0.79%	0.00%	6.56	585363264	0.01%	0.77%	136512671	0.58%	0.62%	0.38%	0.38%	79446531	40253247	51844212	25012260	142.34	35.00	0.51%	0.37%	0.98	0.000	No	0.00%				77.4%	83.8%	94.4%	276.3M	50.7%	97.5%	73689.6Mb	585.4M	55.2%	97.6%	58.4%
V4_0001_RNA_0005_23H5VFLT4_s31_1																																				142.4bp	87.5%	256.2M												82.6%	54%	151bp	151bp	27%	304.9M
V4_0001_RNA_0005_23H5VFLT4_s31_2																																																		81.1%	55%	151bp	151bp	18%	304.9M
V4_0001_RNA_0005_23H5VFLT4_s31_trimmed_1																																																		82.5%	54%	129bp	137bp	18%	292.7M	82.5%	54%	129bp	137bp	18%	292.7M
V4_0001_RNA_0005_23H5VFLT4_s31_trimmed_2																																																		82.1%	55%	129bp	137bp	9%	292.7M	82.1%	55%	129bp	137bp	9%	292.7M
V4_0001_RNA_0005_23H5VFLT4_s33	9999000000	238418002	565910817	0.9342	155.9bp	141.0bp	0.15%	1.07%	0.78%	0.00%	0.27%	3.02%	1.01%	0.00%	6.62	587791732	0.01%	0.60%	237708085	0.79%	0.82%	0.19%	0.18%	188097792	95469159	46141718	21128555	380.09	96.00	0.58%	0.50%	0.98	0.000	No	0.00%				59.9%	87.7%	95.5%	280.7M	38.5%	97.5%	75985.1Mb	587.8M	53.9%	98.0%	48.7%
V4_0001_RNA_0005_23H5VFLT4_s33_1																																				155.9bp	90.3%	265.5M												81.0%	53%	151bp	151bp	27%	363.8M
V4_0001_RNA_0005_23H5VFLT4_s33_2																																																		80.6%	54%	151bp	151bp	18%	363.8M
V4_0001_RNA_0005_23H5VFLT4_s33_trimmed_1																																																		79.4%	53%	132bp	151bp	18%	293.9M	79.4%	53%	132bp	151bp	18%	293.9M
V4_0001_RNA_0005_23H5VFLT4_s33_trimmed_2																																																		80.1%	54%	133bp	151bp	18%	293.9M	80.1%	54%	133bp	151bp	18%	293.9M
V4_0001_RNA_0005_23H5VFLT4_s34	9999000000	207812768	561105984	0.9334	153.7bp	140.0bp	0.14%	1.11%	0.73%	0.00%	0.25%	3.14%	0.96%	0.00%	6.64	584740848	0.01%	0.64%	211864977	0.76%	0.79%	0.22%	0.21%	160762591	81575595	47018548	21763562	320.81	82.00	0.57%	0.48%	0.98	0.000	No	0.00%				64.2%	86.4%	95.1%	278.1M	41.3%	97.5%	75348.8Mb	584.7M	54.1%	97.5%	49.6%
V4_0001_RNA_0005_23H5VFLT4_s34_1																																				153.7bp	89.7%	262.2M												80.9%	53%	151bp	151bp	27%	345.8M
V4_0001_RNA_0005_23H5VFLT4_s34_2																																																		80.5%	54%	151bp	151bp	18%	345.8M
V4_0001_RNA_0005_23H5VFLT4_s34_trimmed_1																																																		79.7%	53%	132bp	151bp	18%	292.4M	79.7%	53%	132bp	151bp	18%	292.4M
V4_0001_RNA_0005_23H5VFLT4_s34_trimmed_2																																																		80.5%	54%	132bp	151bp	18%	292.4M	80.5%	54%	132bp	151bp	18%	292.4M
V4_0001_RNA_0005_23H5VFLT4_s35	9999000000	150509030	442194763	0.9414	150.9bp	138.0bp	0.11%	1.14%	0.69%	0.00%	0.20%	3.19%	0.91%	0.00%	6.57	463097980	0.01%	0.67%	150680863	0.72%	0.75%	0.26%	0.25%	107919657	54770422	39179892	18405057	209.22	51.00	0.54%	0.43%	0.98	0.000	No	0.00%				68.0%	84.8%	94.7%	219.2M	42.0%	97.6%	59380.0Mb	463.1M	55.1%	97.5%	52.2%
V4_0001_RNA_0005_23H5VFLT4_s35_1																																				150.9bp	88.8%	205.7M												79.9%	54%	151bp	151bp	27%	237.4M
V4_0001_RNA_0005_23H5VFLT4_s35_2																																																		78.7%	55%	151bp	151bp	27%	237.4M
V4_0001_RNA_0005_23H5VFLT4_s35_trimmed_1																																																		79.8%	54%	131bp	147bp	18%	231.5M	79.8%	54%	131bp	147bp	18%	231.5M
V4_0001_RNA_0005_23H5VFLT4_s35_trimmed_2																																																		79.6%	55%	131bp	147bp	9%	231.5M	79.6%	55%	131bp	147bp	9%	231.5M
V4_0001_RNA_0005_23H5VFLT4_s36	9990000000	166949853	532672524	0.9301	145.6bp	134.0bp	0.12%	1.17%	0.65%	0.00%	0.22%	3.33%	0.86%	0.00%	6.64	557387630	0.01%	0.71%	164321105	0.66%	0.69%	0.31%	0.31%	108873876	55205369	50868399	24238824	204.68	53.00	0.54%	0.43%	0.98	0.000	No	0.00%				71.1%	85.2%	94.7%	264.0M	44.2%	97.6%	70382.8Mb	557.4M	54.3%	97.7%	55.5%
V4_0001_RNA_0005_23H5VFLT4_s36_1																																				145.6bp	88.0%	245.2M												80.9%	53%	151bp	151bp	27%	285.4M
V4_0001_RNA_0005_23H5VFLT4_s36_2																																																		79.7%	54%	151bp	151bp	18%	285.4M
V4_0001_RNA_0005_23H5VFLT4_s36_trimmed_1																																																		80.8%	54%	129bp	142bp	18%	278.7M	80.8%	54%	129bp	142bp	18%	278.7M
V4_0001_RNA_0005_23H5VFLT4_s36_trimmed_2																																																		80.7%	54%	129bp	142bp	9%	278.7M	80.7%	54%	129bp	142bp	9%	278.7M
V4_0001_RNA_0005_23H5VFLT4_s37	9999000000	147167337	520513214	0.9282	141.8bp	131.0bp	0.12%	1.19%	0.62%	0.00%	0.21%	3.38%	0.83%	0.00%	6.63	545360364	0.01%	0.73%	145693123	0.62%	0.65%	0.35%	0.35%	89752563	45468421	51270840	24644283	163.99	42.00	0.53%	0.40%	0.98	0.000	No	0.00%				73.9%	84.8%	94.6%	258.0M	46.8%	97.6%	68356.5Mb	545.4M	54.3%	97.6%	57.6%
V4_0001_RNA_0005_23H5VFLT4_s37_1																																				141.8bp	87.3%	238.1M												81.6%	53%	151bp	151bp	27%	279.5M
V4_0001_RNA_0005_23H5VFLT4_s37_2																																																		80.3%	54%	151bp	151bp	27%	279.5M
V4_0001_RNA_0005_23H5VFLT4_s37_trimmed_1																																																		81.6%	54%	128bp	137bp	18%	272.7M	81.6%	54%	128bp	137bp	18%	272.7M
V4_0001_RNA_0005_23H5VFLT4_s37_trimmed_2																																																		81.3%	54%	128bp	137bp	9%	272.7M	81.3%	54%	128bp	137bp	9%	272.7M
V4_0001_RNA_0005_23H5VFLT4_s38	9999000000	147843183	501417783	0.9306	140.7bp	129.0bp	0.11%	1.22%	0.61%	0.00%	0.19%	3.43%	0.82%	0.00%	6.57	528286358	0.01%	0.72%	148228308	0.63%	0.66%	0.34%	0.34%	92731207	46972571	50395119	24213503	167.42	43.00	0.53%	0.40%	0.98	0.000	No	0.00%				72.6%	83.0%	94.1%	248.6M	45.6%	97.5%	65416.7Mb	528.3M	55.1%	97.1%	59.5%
V4_0001_RNA_0005_23H5VFLT4_s38_1																																				140.7bp	86.9%	229.6M												80.7%	54%	151bp	151bp	27%	272.1M
V4_0001_RNA_0005_23H5VFLT4_s38_2																																																		79.4%	55%	151bp	151bp	36%	272.1M
V4_0001_RNA_0005_23H5VFLT4_s38_trimmed_1																																																		80.6%	54%	127bp	137bp	18%	264.1M	80.6%	54%	127bp	137bp	18%	264.1M
V4_0001_RNA_0005_23H5VFLT4_s38_trimmed_2																																																		80.4%	55%	127bp	137bp	9%	264.1M	80.4%	55%	127bp	137bp	9%	264.1M
V4_0001_RNA_0005_23H5VFLT4_s39	9999000000	164101280	470856377	0.9274	143.3bp	133.0bp	0.11%	1.17%	0.58%	0.00%	0.20%	3.31%	0.79%	0.00%	6.54	494713366	0.01%	0.73%	133176882	0.61%	0.64%	0.36%	0.36%	81007949	41068610	47522656	22859158	147.43	37.00	0.52%	0.37%	0.97	0.000	No	0.00%				73.8%	83.9%	94.4%	233.4M	45.7%	97.3%	62036.5Mb	494.7M	55.1%	97.7%	57.4%
V4_0001_RNA_0005_23H5VFLT4_s39_1																																				143.3bp	87.1%	215.5M												80.6%	54%	151bp	151bp	27%	253.1M
V4_0001_RNA_0005_23H5VFLT4_s39_2																																																		79.1%	55%	151bp	151bp	18%	253.1M
V4_0001_RNA_0005_23H5VFLT4_s39_trimmed_1																																																		80.6%	54%	129bp	142bp	18%	247.4M	80.6%	54%	129bp	142bp	18%	247.4M
V4_0001_RNA_0005_23H5VFLT4_s39_trimmed_2																																																		80.2%	55%	129bp	142bp	9%	247.4M	80.2%	55%	129bp	142bp	9%	247.4M
V4_0001_RNA_0005_23H5VFLT4_s41	9999000000	234708349	564268653	0.9329	150.3bp	137.0bp	0.16%	1.12%	0.81%	0.00%	0.29%	3.12%	1.05%	0.00%	6.55	587277200	0.01%	0.61%	230340590	0.79%	0.82%	0.19%	0.18%	181904052	92243623	44888008	20670165	362.26	88.00	0.57%	0.49%	0.98	0.000	No	0.00%				61.1%	87.2%	95.4%	280.0M	38.2%	97.5%	74851.7Mb	587.3M	54.6%	97.9%	51.4%
V4_0001_RNA_0005_23H5VFLT4_s41_1																																				150.3bp	90.7%	266.3M												82.8%	54%	151bp	151bp	27%	428.0M
V4_0001_RNA_0005_23H5VFLT4_s41_2																																																		82.4%	54%	151bp	151bp	18%	428.0M
V4_0001_RNA_0005_23H5VFLT4_s41_trimmed_1																																																		79.9%	54%	131bp	147bp	27%	293.6M	79.9%	54%	131bp	147bp	27%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s41_trimmed_2																																																		80.8%	54%	131bp	147bp	18%	293.6M	80.8%	54%	131bp	147bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s42	9999000000	205211921	562746914	0.9391	152.7bp	139.0bp	0.13%	1.11%	0.73%	0.00%	0.24%	3.11%	0.97%	0.00%	6.59	586637154	0.01%	0.65%	206594565	0.75%	0.78%	0.23%	0.22%	155158851	78742135	47342253	21959917	307.42	77.00	0.57%	0.48%	0.98	0.000	No	0.00%				65.2%	86.5%	95.1%	279.0M	41.5%	97.5%	75511.6Mb	586.6M	54.3%	97.8%	50.1%
V4_0001_RNA_0005_23H5VFLT4_s42_1																																				152.7bp	89.7%	263.1M												82.4%	53%	151bp	151bp	27%	367.7M
V4_0001_RNA_0005_23H5VFLT4_s42_2																																																		81.6%	54%	151bp	151bp	18%	367.7M
V4_0001_RNA_0005_23H5VFLT4_s42_trimmed_1																																																		80.7%	54%	132bp	151bp	18%	293.3M	80.7%	54%	132bp	151bp	18%	293.3M
V4_0001_RNA_0005_23H5VFLT4_s42_trimmed_2																																																		81.1%	54%	132bp	151bp	18%	293.3M	81.1%	54%	132bp	151bp	18%	293.3M
V4_0001_RNA_0005_23H5VFLT4_s43	9990000000	163906738	560680792	0.9344	145.2bp	132.0bp	0.13%	1.17%	0.70%	0.00%	0.24%	3.28%	0.92%	0.00%	6.64	586161470	0.01%	0.71%	169348478	0.68%	0.71%	0.30%	0.29%	114841797	58230000	50110084	23780304	215.80	54.00	0.54%	0.44%	0.98	0.000	No	0.00%				71.6%	85.6%	94.9%	278.1M	45.3%	97.6%	73837.0Mb	586.2M	54.2%	97.7%	54.9%
V4_0001_RNA_0005_23H5VFLT4_s43_1																																				145.2bp	88.6%	259.6M												82.9%	53%	151bp	151bp	27%	355.2M
V4_0001_RNA_0005_23H5VFLT4_s43_2																																																		81.5%	54%	151bp	151bp	18%	355.2M
V4_0001_RNA_0005_23H5VFLT4_s43_trimmed_1																																																		81.4%	53%	129bp	142bp	18%	293.1M	81.4%	53%	129bp	142bp	18%	293.1M
V4_0001_RNA_0005_23H5VFLT4_s43_trimmed_2																																																		81.3%	54%	129bp	142bp	18%	293.1M	81.3%	54%	129bp	142bp	18%	293.1M
V4_0001_RNA_0005_23H5VFLT4_s44	9999000000	164591990	515295847	0.9359	143.1bp	130.0bp	0.12%	1.20%	0.66%	0.00%	0.23%	3.38%	0.88%	0.00%	6.63	540826240	0.01%	0.70%	162677663	0.67%	0.70%	0.30%	0.30%	108864764	55173026	49254945	23465907	201.66	52.00	0.54%	0.43%	0.98	0.000	No	0.00%				70.5%	84.2%	94.5%	255.5M	43.8%	97.5%	67442.2Mb	540.8M	54.6%	97.3%	57.3%
V4_0001_RNA_0005_23H5VFLT4_s44_1																																				143.1bp	87.9%	237.8M												80.6%	54%	151bp	151bp	27%	278.0M
V4_0001_RNA_0005_23H5VFLT4_s44_2																																																		79.6%	55%	151bp	151bp	27%	278.0M
V4_0001_RNA_0005_23H5VFLT4_s44_trimmed_1																																																		80.6%	54%	128bp	137bp	18%	270.4M	80.6%	54%	128bp	137bp	18%	270.4M
V4_0001_RNA_0005_23H5VFLT4_s44_trimmed_2																																																		80.6%	54%	128bp	137bp	9%	270.4M	80.6%	54%	128bp	137bp	9%	270.4M
V4_0001_RNA_0005_23H5VFLT4_s45	9999000000	140224967	530238482	0.9336	137.6bp	127.0bp	0.12%	1.23%	0.64%	0.00%	0.21%	3.45%	0.86%	0.00%	6.58	557707196	0.01%	0.75%	139623794	0.60%	0.63%	0.37%	0.37%	83321479	42179178	51224064	24716275	147.25	36.00	0.52%	0.38%	0.98	0.000	No	0.00%				75.7%	83.5%	94.3%	263.0M	47.4%	97.5%	68307.1Mb	557.7M	54.9%	97.1%	61.6%
V4_0001_RNA_0005_23H5VFLT4_s45_1																																				137.6bp	87.4%	243.7M												82.3%	54%	151bp	151bp	27%	287.2M
V4_0001_RNA_0005_23H5VFLT4_s45_2																																																		80.8%	55%	151bp	151bp	36%	287.2M
V4_0001_RNA_0005_23H5VFLT4_s45_trimmed_1																																																		82.3%	54%	126bp	132bp	18%	278.9M	82.3%	54%	126bp	132bp	18%	278.9M
V4_0001_RNA_0005_23H5VFLT4_s45_trimmed_2																																																		81.9%	55%	126bp	132bp	9%	278.9M	81.9%	55%	126bp	132bp	9%	278.9M
V4_0001_RNA_0005_23H5VFLT4_s46	9999000000	147309160	445694015	0.9396	142.6bp	131.0bp	0.11%	1.21%	0.61%	0.00%	0.20%	3.40%	0.82%	0.00%	6.59	469384996	0.01%	0.70%	139855169	0.64%	0.67%	0.33%	0.33%	89211888	45203564	46258955	22176812	162.26	41.00	0.53%	0.39%	0.98	0.000	No	0.00%				70.9%	83.2%	94.2%	221.0M	44.0%	97.5%	58332.4Mb	469.4M	55.0%	97.5%	58.5%
V4_0001_RNA_0005_23H5VFLT4_s46_1																																				142.6bp	86.8%	203.8M												79.7%	54%	151bp	151bp	27%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s46_2																																																		78.5%	55%	151bp	151bp	27%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s46_trimmed_1																																																		79.7%	54%	127bp	137bp	18%	234.7M	79.7%	54%	127bp	137bp	18%	234.7M
V4_0001_RNA_0005_23H5VFLT4_s46_trimmed_2																																																		79.6%	55%	128bp	137bp	9%	234.7M	79.6%	55%	128bp	137bp	9%	234.7M
V4_0001_RNA_0005_23H5VFLT4_s47	9999000000	135973586	552641209	0.9328	137.1bp	126.0bp	0.11%	1.23%	0.61%	0.00%	0.19%	3.45%	0.82%	0.00%	6.54	582808226	0.01%	0.77%	135323364	0.56%	0.60%	0.39%	0.40%	76176175	38550621	53387450	25820410	132.90	33.00	0.51%	0.35%	0.98	0.000	No	0.00%				77.5%	82.7%	94.0%	273.9M	48.4%	97.5%	71275.4Mb	582.8M	55.3%	97.1%	62.2%
V4_0001_RNA_0005_23H5VFLT4_s47_1																																				137.1bp	86.9%	253.3M												82.8%	54%	151bp	151bp	27%	301.9M
V4_0001_RNA_0005_23H5VFLT4_s47_2																																																		81.4%	55%	151bp	151bp	36%	301.9M
V4_0001_RNA_0005_23H5VFLT4_s47_trimmed_1																																																		82.8%	55%	125bp	132bp	18%	291.4M	82.8%	55%	125bp	132bp	18%	291.4M
V4_0001_RNA_0005_23H5VFLT4_s47_trimmed_2																																																		82.5%	55%	126bp	132bp	9%	291.4M	82.5%	55%	126bp	132bp	9%	291.4M
tih_rna_sample_00087_23H5VFLT4_s17	9999000000	521750832	574954705	0.9223	146.9bp	136.0bp	0.15%	1.17%	0.50%	0.00%	0.35%	3.64%	0.70%	0.00%	0.06	594921736	0.01%	0.42%	345025790	0.84%	0.86%	0.15%	0.14%	289592678	146518007	52332236	24037242	572.17	273.00	0.72%	0.62%	0.98	0.000	No	0.00%				42.2%	89.0%	95.7%	284.6M	29.0%	97.7%	76323.1Mb	594.9M	52.5%	99.2%	52.9%
tih_rna_sample_00087_23H5VFLT4_s17_1																																				146.9bp	91.5%	272.2M												79.1%	52%	151bp	151bp	27%	413.7M
tih_rna_sample_00087_23H5VFLT4_s17_2																																																		78.6%	52%	151bp	151bp	18%	413.7M
tih_rna_sample_00087_23H5VFLT4_s17_trimmed_1																																																		76.8%	52%	131bp	147bp	18%	297.5M	76.8%	52%	131bp	147bp	18%	297.5M
tih_rna_sample_00087_23H5VFLT4_s17_trimmed_2																																																		76.8%	52%	131bp	147bp	9%	297.5M	76.8%	52%	131bp	147bp	9%	297.5M
tih_rna_sample_00088_23H5VFLT4_s02	9999000000	292574668	573318611	0.8650	136.9bp	127.0bp	0.05%	0.34%	0.32%	0.00%	0.12%	1.22%	0.55%	0.00%	5.44	592632772	0.01%	0.57%	255137738	0.85%	0.87%	0.14%	0.13%	216157032	109161774	34984489	16022077	401.98	187.00	0.73%	0.61%	0.98	0.000	Yes	0.00%				57.3%	88.1%	95.7%	283.6M	36.2%	97.5%	73734.8Mb	592.6M	58.3%	98.8%	60.5%
tih_rna_sample_00088_23H5VFLT4_s02_1																																				136.9bp	93.8%	278.1M												81.1%	57%	151bp	151bp	27%	412.7M
tih_rna_sample_00088_23H5VFLT4_s02_2																																																		80.4%	57%	151bp	151bp	27%	412.7M
tih_rna_sample_00088_23H5VFLT4_s02_trimmed_1																																																		78.4%	58%	128bp	137bp	27%	296.3M	78.4%	58%	128bp	137bp	27%	296.3M
tih_rna_sample_00088_23H5VFLT4_s02_trimmed_2																																																		78.7%	58%	128bp	137bp	18%	296.3M	78.7%	58%	128bp	137bp	18%	296.3M
tih_rna_sample_00089_23H5VFLT4_s39	9999000000	392020115	574927301	0.9032	148.2bp	137.0bp	0.18%	0.98%	0.49%	0.00%	0.40%	3.02%	0.73%	0.00%	3.91	593819066	0.00%	0.48%	309891015	0.87%	0.89%	0.12%	0.11%	269090179	136184846	37861598	16848243	532.95	256.00	0.73%	0.63%	0.98	0.000	No	0.00%				48.1%	88.8%	95.8%	284.5M	33.6%	97.7%	76749.4Mb	593.8M	55.3%	99.0%	52.2%
tih_rna_sample_00089_23H5VFLT4_s39_1																																				148.2bp	93.8%	278.5M												81.1%	54%	151bp	151bp	27%	390.3M
tih_rna_sample_00089_23H5VFLT4_s39_2																																																		80.7%	55%	151bp	151bp	18%	390.3M
tih_rna_sample_00089_23H5VFLT4_s39_trimmed_1																																																		79.1%	55%	132bp	147bp	18%	296.9M	79.1%	55%	132bp	147bp	18%	296.9M
tih_rna_sample_00089_23H5VFLT4_s39_trimmed_2																																																		79.6%	55%	132bp	147bp	9%	296.9M	79.6%	55%	132bp	147bp	9%	296.9M
tih_rna_sample_00090_23H5VFLT4_s32	9999000000	291811453	559004895	0.9154	124.6bp	119.0bp	0.10%	0.91%	0.51%	0.00%	0.18%	2.58%	0.73%	0.00%	5.63	592262810	0.01%	0.55%	267676074	0.85%	0.88%	0.13%	0.12%	227609416	114694057	33624024	15507541	384.62	112.00	0.66%	0.52%	0.98	0.000	Yes	0.00%				55.4%	80.9%	93.2%	276.0M	31.9%	97.5%	69879.5Mb	592.3M	59.7%	98.7%	71.3%
tih_rna_sample_00090_23H5VFLT4_s32_1																																				124.6bp	93.2%	276.1M												79.7%	57%	151bp	151bp	27%	352.9M
tih_rna_sample_00090_23H5VFLT4_s32_2																																																		79.4%	58%	151bp	151bp	36%	352.9M
tih_rna_sample_00090_23H5VFLT4_s32_trimmed_1																																																		78.4%	59%	121bp	122bp	18%	296.1M	78.4%	59%	121bp	122bp	18%	296.1M
tih_rna_sample_00090_23H5VFLT4_s32_trimmed_2																																																		79.0%	59%	121bp	127bp	9%	296.1M	79.0%	59%	121bp	127bp	9%	296.1M
tih_rna_sample_00096_23H5VFLT4_s11	9999000000	400314222	576555130	0.8843	143.7bp	135.0bp	0.21%	0.53%	0.29%	0.00%	0.44%	1.65%	0.42%	0.00%	0.06	594163996	0.01%	0.46%	318959170	0.84%	0.87%	0.15%	0.13%	269453970	136329997	46458875	21222955	521.83	269.00	0.76%	0.65%	0.98	0.000	No	0.00%				46.6%	89.6%	96.1%	285.4M	31.9%	97.7%	75721.8Mb	594.2M	54.5%	99.0%	55.0%
tih_rna_sample_00096_23H5VFLT4_s11_1																																				143.7bp	92.2%	273.9M												77.1%	53%	151bp	151bp	27%	308.6M
tih_rna_sample_00096_23H5VFLT4_s11_2																																																		76.5%	54%	151bp	151bp	18%	308.6M
tih_rna_sample_00096_23H5VFLT4_s11_trimmed_1																																																		77.0%	54%	130bp	142bp	18%	297.1M	77.0%	54%	130bp	142bp	18%	297.1M
tih_rna_sample_00096_23H5VFLT4_s11_trimmed_2																																																		77.1%	54%	130bp	142bp	9%	297.1M	77.1%	54%	130bp	142bp	9%	297.1M
tih_rna_sample_00097_23H5VFLT4_s12	9999000000	369890717	573284651	0.8635	131.0bp	123.0bp	0.25%	1.79%	0.64%	0.00%	0.47%	4.91%	0.87%	0.00%	0.04	594438694	0.01%	0.51%	292923620	0.84%	0.86%	0.15%	0.14%	246399636	124374579	43512304	20261418	438.13	198.00	0.71%	0.60%	0.98	0.000	No	0.00%				51.0%	87.4%	95.4%	283.5M	31.6%	97.6%	72204.3Mb	594.4M	52.5%	99.1%	66.5%
tih_rna_sample_00097_23H5VFLT4_s12_1																																				131.0bp	92.5%	275.0M												79.6%	52%	151bp	151bp	27%	364.2M
tih_rna_sample_00097_23H5VFLT4_s12_2																																																		79.0%	52%	151bp	151bp	18%	364.2M
tih_rna_sample_00097_23H5VFLT4_s12_trimmed_1																																																		78.2%	52%	124bp	132bp	18%	297.2M	78.2%	52%	124bp	132bp	18%	297.2M
tih_rna_sample_00097_23H5VFLT4_s12_trimmed_2																																																		78.2%	52%	124bp	132bp	9%	297.2M	78.2%	52%	124bp	132bp	9%	297.2M
tih_rna_sample_00104_23H5VFLT4_s20	9999000000	109558403	389097422	0.8685	117.3bp	113.0bp	0.27%	0.61%	0.28%	0.00%	0.56%	1.84%	0.43%	0.00%	5.41	414319340	0.01%	0.77%	95368014	0.59%	0.63%	0.35%	0.37%	55850573	28093390	33807248	16554869	80.37	28.00	0.49%	0.23%	0.98	0.000	No	0.00%				78.1%	78.3%	92.7%	192.0M	46.4%	97.4%	46841.5Mb	414.3M	58.8%	98.3%	79.9%
tih_rna_sample_00104_23H5VFLT4_s20_1																																				117.3bp	89.1%	184.6M												80.1%	56%	151bp	151bp	27%	210.8M
tih_rna_sample_00104_23H5VFLT4_s20_2																																																		78.7%	57%	151bp	151bp	27%	210.8M
tih_rna_sample_00104_23H5VFLT4_s20_trimmed_1																																																		80.1%	58%	116bp	117bp	18%	207.2M	80.1%	58%	116bp	117bp	18%	207.2M
tih_rna_sample_00104_23H5VFLT4_s20_trimmed_2																																																		79.6%	58%	116bp	117bp	9%	207.2M	79.6%	58%	116bp	117bp	9%	207.2M
tih_rna_sample_00105_23H5VFLT4_s21	9999000000	62502539	102497818	0.8497	103.0bp	100.0bp	0.23%	0.48%	0.27%	0.00%	0.49%	1.50%	0.39%	0.00%	0.25	110239562	0.02%	0.65%	38968469	0.44%	0.47%	0.51%	0.53%	17314875	8691792	19952434	9893525	21.63	8.00	0.21%	0.04%	0.98	0.000	No	0.00%				65.7%	75.1%	91.6%	50.5M	31.5%	97.6%	11139.4Mb	110.2M	53.6%	97.2%	89.4%
tih_rna_sample_00105_23H5VFLT4_s21_1																																				103.0bp	79.2%	43.7M												67.5%	53%	151bp	151bp	36%	56.7M
tih_rna_sample_00105_23H5VFLT4_s21_2																																																		66.3%	54%	151bp	151bp	45%	56.7M
tih_rna_sample_00105_23H5VFLT4_s21_trimmed_1																																																		67.0%	53%	104bp	102bp	18%	55.1M	67.0%	53%	104bp	102bp	18%	55.1M
tih_rna_sample_00105_23H5VFLT4_s21_trimmed_2																																																		66.3%	53%	104bp	102bp	9%	55.1M	66.3%	53%	104bp	102bp	9%	55.1M
tih_rna_sample_00111_23H5VFLT4_s30	9999000000	112596413	320916916	0.8734	127.2bp	122.0bp	0.09%	0.68%	0.21%	0.00%	0.21%	2.22%	0.34%	0.00%	0.10	337195840	0.01%	0.73%	90687111	0.54%	0.57%	0.42%	0.43%	48877382	24636871	37723194	18518352	76.35	35.00	0.53%	0.23%	0.98	0.000	No	0.00%				74.0%	83.2%	94.0%	158.4M	48.9%	97.5%	40437.9Mb	337.2M	55.2%	98.6%	71.2%
tih_rna_sample_00111_23H5VFLT4_s30_1																																				127.2bp	86.4%	145.7M												77.7%	54%	151bp	151bp	27%	171.0M
tih_rna_sample_00111_23H5VFLT4_s30_2																																																		76.2%	55%	151bp	151bp	18%	171.0M
tih_rna_sample_00111_23H5VFLT4_s30_trimmed_1																																																		77.8%	55%	123bp	127bp	18%	168.6M	77.8%	55%	123bp	127bp	18%	168.6M
tih_rna_sample_00111_23H5VFLT4_s30_trimmed_2																																																		77.0%	55%	123bp	127bp	9%	168.6M	77.0%	55%	123bp	127bp	9%	168.6M
tih_rna_sample_00115_23H5VFLT4_s35	9999000000	168054302	475978287	0.8896	114.0bp	109.0bp	0.12%	0.34%	0.38%	0.00%	0.26%	1.14%	0.58%	0.00%	0.07	497553714	0.01%	0.70%	148909926	0.67%	0.69%	0.31%	0.31%	99034544	49818900	45491055	22238628	146.93	67.00	0.64%	0.41%	0.98	0.000	No	0.00%				70.7%	83.9%	94.5%	235.0M	41.4%	97.6%	55008.4Mb	497.6M	55.5%	98.8%	81.2%
tih_rna_sample_00115_23H5VFLT4_s35_1																																				114.0bp	89.7%	223.2M												78.4%	54%	151bp	151bp	27%	251.8M
tih_rna_sample_00115_23H5VFLT4_s35_2																																																		77.4%	55%	151bp	151bp	36%	251.8M
tih_rna_sample_00115_23H5VFLT4_s35_trimmed_1																																																		78.5%	55%	113bp	112bp	18%	248.8M	78.5%	55%	113bp	112bp	18%	248.8M
tih_rna_sample_00115_23H5VFLT4_s35_trimmed_2																																																		78.1%	55%	113bp	112bp	9%	248.8M	78.1%	55%	113bp	112bp	9%	248.8M
tih_rna_sample_00116_23H5VFLT4_s36	9999000000	284648584	571723560	0.7171	122.7bp	117.0bp	0.18%	0.98%	0.62%	0.00%	0.32%	2.75%	0.83%	0.00%	5.01	592921514	0.01%	0.56%	258875620	0.83%	0.85%	0.16%	0.15%	213744558	107694290	41036529	19356717	354.03	165.00	0.72%	0.59%	0.98	0.000	No	0.00%				56.7%	87.3%	95.3%	282.5M	32.4%	97.6%	69160.8Mb	592.9M	55.0%	98.8%	73.9%
tih_rna_sample_00116_23H5VFLT4_s36_1																																				122.7bp	92.5%	274.3M												79.9%	54%	151bp	151bp	27%	354.2M
tih_rna_sample_00116_23H5VFLT4_s36_2																																																		79.1%	54%	151bp	151bp	27%	354.2M
tih_rna_sample_00116_23H5VFLT4_s36_trimmed_1																																																		78.7%	54%	119bp	122bp	18%	296.5M	78.7%	54%	119bp	122bp	18%	296.5M
tih_rna_sample_00116_23H5VFLT4_s36_trimmed_2																																																		78.6%	55%	120bp	122bp	9%	296.5M	78.6%	55%	120bp	122bp	9%	296.5M
tih_rna_sample_00117_23H5VFLT4_s37	9999000000	103307071	398416798	0.9178	131.6bp	124.0bp	0.13%	0.48%	0.33%	0.00%	0.27%	1.59%	0.51%	0.00%	0.11	414808524	0.01%	0.78%	90101202	0.61%	0.64%	0.35%	0.36%	55325345	27896838	31674119	15403765	93.40	43.00	0.57%	0.28%	0.98	0.000	No	0.00%				78.9%	86.6%	95.2%	197.3M	52.3%	97.6%	50484.5Mb	414.8M	55.9%	98.6%	67.0%
tih_rna_sample_00117_23H5VFLT4_s37_1																																				131.6bp	90.9%	188.5M												82.2%	54%	151bp	151bp	27%	210.4M
tih_rna_sample_00117_23H5VFLT4_s37_2																																																		80.8%	55%	151bp	151bp	18%	210.4M
tih_rna_sample_00117_23H5VFLT4_s37_trimmed_1																																																		82.3%	55%	125bp	132bp	18%	207.4M	82.3%	55%	125bp	132bp	18%	207.4M
tih_rna_sample_00117_23H5VFLT4_s37_trimmed_2																																																		81.8%	56%	125bp	132bp	9%	207.4M	81.8%	56%	125bp	132bp	9%	207.4M
tih_rna_sample_00118_23H5VFLT4_s38	9999000000	379134973	574321026	0.8347	142.2bp	132.0bp	0.35%	1.42%	0.51%	0.00%	0.79%	4.22%	0.76%	0.00%	4.42	593528608	0.01%	0.49%	305187759	0.86%	0.88%	0.13%	0.12%	263481646	133303526	38648054	17338073	504.63	240.00	0.73%	0.62%	0.98	0.000	No	0.00%				48.8%	88.5%	95.8%	284.4M	33.1%	97.7%	75089.4Mb	593.5M	54.7%	98.9%	57.2%
tih_rna_sample_00118_23H5VFLT4_s38_1																																				142.2bp	93.4%	277.1M												80.4%	54%	151bp	151bp	27%	338.0M
tih_rna_sample_00118_23H5VFLT4_s38_2																																																		79.7%	54%	151bp	151bp	18%	338.0M
tih_rna_sample_00118_23H5VFLT4_s38_trimmed_1																																																		79.5%	54%	129bp	142bp	18%	296.8M	79.5%	54%	129bp	142bp	18%	296.8M
tih_rna_sample_00118_23H5VFLT4_s38_trimmed_2																																																		79.6%	54%	130bp	142bp	9%	296.8M	79.6%	54%	130bp	142bp	9%	296.8M
tih_rna_sample_00121_23H5VFLT4_s41	9999000000	314091931	568587616	0.8947	129.0bp	121.0bp	0.17%	0.61%	0.32%	0.00%	0.40%	1.97%	0.50%	0.00%	0.09	592865102	0.01%	0.54%	270896228	0.78%	0.81%	0.20%	0.19%	211468601	106759746	54316358	25775463	369.09	189.00	0.75%	0.62%	0.98	0.000	No	0.00%				54.8%	85.5%	94.8%	281.1M	33.3%	97.5%	71341.4Mb	592.9M	56.2%	98.8%	66.7%
tih_rna_sample_00121_23H5VFLT4_s41_1																																				129.0bp	89.8%	266.1M												77.0%	55%	151bp	151bp	36%	309.5M
tih_rna_sample_00121_23H5VFLT4_s41_2																																																		76.5%	55%	151bp	151bp	27%	309.5M
tih_rna_sample_00121_23H5VFLT4_s41_trimmed_1																																																		76.9%	56%	123bp	127bp	27%	296.4M	76.9%	56%	123bp	127bp	27%	296.4M
tih_rna_sample_00121_23H5VFLT4_s41_trimmed_2																																																		77.0%	56%	123bp	127bp	18%	296.4M	77.0%	56%	123bp	127bp	18%	296.4M
tih_rna_sample_00122_23H5VFLT4_s42	9999000000	231639256	405224958	0.9074	118.8bp	113.0bp	0.30%	0.85%	0.32%	0.00%	0.62%	2.63%	0.46%	0.00%	0.13	424453366	0.01%	0.55%	189510223	0.69%	0.71%	0.29%	0.29%	131272400	66066271	54929542	26806312	205.09	97.00	0.67%	0.49%	0.98	0.000	No	0.00%				55.8%	83.3%	94.3%	200.2M	31.6%	97.7%	48279.7Mb	424.5M	52.8%	98.8%	77.4%
tih_rna_sample_00122_23H5VFLT4_s42_1																																				118.8bp	86.1%	182.7M												70.9%	52%	151bp	151bp	27%	214.8M
tih_rna_sample_00122_23H5VFLT4_s42_2																																																		69.9%	53%	151bp	151bp	36%	214.8M
tih_rna_sample_00122_23H5VFLT4_s42_trimmed_1																																																		70.9%	52%	116bp	117bp	18%	212.2M	70.9%	52%	116bp	117bp	18%	212.2M
tih_rna_sample_00122_23H5VFLT4_s42_trimmed_2																																																		70.5%	52%	116bp	117bp	9%	212.2M	70.5%	52%	116bp	117bp	9%	212.2M
tih_rna_sample_00124_23H5VFLT4_s31	9999000000	395783263	576202399	0.9137	145.2bp	135.0bp	0.10%	0.69%	0.37%	0.00%	0.23%	2.28%	0.58%	0.00%	0.04	593847112	0.01%	0.48%	311668958	0.84%	0.86%	0.15%	0.14%	262404747	132830829	45538628	20737989	513.08	284.00	0.78%	0.66%	0.98	0.000	Yes	0.06%				47.8%	89.7%	95.9%	284.7M	32.6%	97.7%	75958.4Mb	593.8M	53.8%	99.0%	53.9%
tih_rna_sample_00124_23H5VFLT4_s31_1																																				145.2bp	91.9%	273.0M												77.6%	53%	151bp	151bp	27%	350.8M
tih_rna_sample_00124_23H5VFLT4_s31_2																																																		77.5%	53%	151bp	151bp	18%	350.8M
tih_rna_sample_00124_23H5VFLT4_s31_trimmed_1																																																		76.3%	53%	131bp	147bp	18%	296.9M	76.3%	53%	131bp	147bp	18%	296.9M
tih_rna_sample_00124_23H5VFLT4_s31_trimmed_2																																																		76.9%	54%	131bp	147bp	9%	296.9M	76.9%	54%	131bp	147bp	9%	296.9M
tih_rna_sample_00127_23H5VFLT4_s08	9999000000	232503664	440086985	0.8549	121.6bp	115.0bp	0.20%	1.01%	0.36%	0.00%	0.42%	3.08%	0.54%	0.00%	0.07	456491162	0.01%	0.56%	202675940	0.78%	0.80%	0.21%	0.20%	157537463	79397534	41893053	20064936	257.55	134.00	0.71%	0.56%	0.98	0.000	No	0.00%				56.0%	86.2%	95.0%	216.9M	31.6%	97.7%	52864.3Mb	456.5M	53.9%	98.8%	74.2%
tih_rna_sample_00127_23H5VFLT4_s08_1																																				121.6bp	90.4%	206.2M												73.7%	53%	151bp	151bp	27%	230.9M
tih_rna_sample_00127_23H5VFLT4_s08_2																																																		72.5%	53%	151bp	151bp	36%	230.9M
tih_rna_sample_00127_23H5VFLT4_s08_trimmed_1																																																		73.8%	53%	118bp	122bp	18%	228.2M	73.8%	53%	118bp	122bp	18%	228.2M
tih_rna_sample_00127_23H5VFLT4_s08_trimmed_2																																																		73.1%	54%	119bp	122bp	9%	228.2M	73.1%	54%	119bp	122bp	9%	228.2M
tih_rna_sample_00163_23H5VFLT4_s43	9999000000	385496045	576096825	0.9093	139.7bp	130.0bp	0.21%	0.99%	0.38%	0.00%	0.44%	3.09%	0.57%	0.00%	0.05	594202206	0.01%	0.49%	300909809	0.84%	0.86%	0.15%	0.14%	251929546	127415905	45922890	21119023	479.14	247.00	0.76%	0.64%	0.98	0.000	No	0.00%				49.6%	89.9%	96.1%	285.5M	33.3%	97.8%	74698.5Mb	594.2M	53.6%	99.0%	57.8%
tih_rna_sample_00163_23H5VFLT4_s43_1																																				139.7bp	92.2%	274.0M												80.9%	53%	151bp	151bp	27%	400.7M
tih_rna_sample_00163_23H5VFLT4_s43_2																																																		80.2%	53%	151bp	151bp	18%	400.7M
tih_rna_sample_00163_23H5VFLT4_s43_trimmed_1																																																		78.8%	53%	129bp	137bp	18%	297.1M	78.8%	53%	129bp	137bp	18%	297.1M
tih_rna_sample_00163_23H5VFLT4_s43_trimmed_2																																																		78.6%	53%	129bp	137bp	9%	297.1M	78.6%	53%	129bp	137bp	9%	297.1M
tih_rna_sample_00218_23H5VFLT4_s10	9990000000	438027321	578373952	0.8863	145.9bp	135.0bp	0.15%	0.64%	0.44%	0.00%	0.33%	2.10%	0.67%	0.00%	5.61	594814156	0.00%	0.47%	316122734	0.89%	0.91%	0.10%	0.09%	280078786	141635441	33107360	14547116	554.25	257.00	0.74%	0.63%	0.98	0.000	No	0.00%				47.1%	90.3%	96.2%	286.1M	31.9%	97.8%	76238.1Mb	594.8M	53.8%	99.1%	53.7%
tih_rna_sample_00218_23H5VFLT4_s10_1																																				145.9bp	94.8%	282.0M												80.4%	53%	151bp	151bp	27%	348.9M
tih_rna_sample_00218_23H5VFLT4_s10_2																																																		80.4%	53%	151bp	151bp	18%	348.9M
tih_rna_sample_00218_23H5VFLT4_s10_trimmed_1																																																		79.4%	53%	131bp	147bp	18%	297.4M	79.4%	53%	131bp	147bp	18%	297.4M
tih_rna_sample_00218_23H5VFLT4_s10_trimmed_2																																																		80.0%	54%	131bp	147bp	9%	297.4M	80.0%	54%	131bp	147bp	9%	297.4M
tih_rna_sample_00220_23H5VFLT4_s16	9999000000	192959974	575615737	0.8347	138.6bp	130.0bp	0.11%	0.57%	0.26%	0.00%	0.24%	1.95%	0.43%	0.00%	0.07	593952130	0.01%	0.67%	197647807	0.78%	0.80%	0.20%	0.20%	153514709	77616236	40402313	19048639	281.89	133.00	0.71%	0.55%	0.98	0.000	No	0.00%				67.1%	88.7%	95.8%	284.6M	45.8%	97.6%	74873.1Mb	594.0M	56.7%	99.0%	59.2%
tih_rna_sample_00220_23H5VFLT4_s16_1																																				138.6bp	92.3%	274.0M												79.7%	55%	151bp	151bp	27%	310.8M
tih_rna_sample_00220_23H5VFLT4_s16_2																																																		78.8%	56%	151bp	151bp	18%	310.8M
tih_rna_sample_00220_23H5VFLT4_s16_trimmed_1																																																		79.5%	56%	129bp	137bp	27%	297.0M	79.5%	56%	129bp	137bp	27%	297.0M
tih_rna_sample_00220_23H5VFLT4_s16_trimmed_2																																																		79.3%	56%	129bp	137bp	9%	297.0M	79.3%	56%	129bp	137bp	9%	297.0M
tih_rna_sample_00235_23H5VFLT4_s07	9999000000	490574335	576928444	0.8780	146.1bp	136.0bp	0.11%	0.89%	0.32%	0.00%	0.23%	2.63%	0.50%	0.00%	0.04	594334090	0.01%	0.43%	336378024	0.87%	0.90%	0.12%	0.10%	293730077	148730346	39293016	17367677	577.35	297.00	0.78%	0.67%	0.98	0.000	No	0.00%				43.6%	89.5%	96.0%	285.2M	29.8%	97.8%	76177.3Mb	594.3M	54.0%	99.1%	53.5%
tih_rna_sample_00235_23H5VFLT4_s07_1																																				146.1bp	93.4%	277.4M												81.0%	53%	151bp	151bp	27%	492.6M
tih_rna_sample_00235_23H5VFLT4_s07_2																																																		80.7%	54%	151bp	151bp	18%	492.6M
tih_rna_sample_00235_23H5VFLT4_s07_trimmed_1																																																		77.3%	53%	131bp	147bp	18%	297.2M	77.3%	53%	131bp	147bp	18%	297.2M
tih_rna_sample_00235_23H5VFLT4_s07_trimmed_2																																																		77.8%	54%	131bp	147bp	9%	297.2M	77.8%	54%	131bp	147bp	9%	297.2M
tih_rna_sample_00248_23H5VFLT4_s01	9999000000	355873404	573159226	0.8687	136.6bp	128.0bp	0.19%	0.96%	0.35%	0.00%	0.38%	2.95%	0.54%	0.00%	0.05	593769264	0.01%	0.49%	300642471	0.84%	0.86%	0.15%	0.14%	251303913	126942848	45919075	21287875	464.08	223.00	0.72%	0.61%	0.98	0.000	No	0.00%				49.7%	87.6%	95.3%	283.1M	30.5%	97.6%	73651.6Mb	593.8M	54.2%	99.0%	61.4%
tih_rna_sample_00248_23H5VFLT4_s01_1																																				136.6bp	92.3%	274.0M												75.0%	53%	151bp	151bp	27%	308.1M
tih_rna_sample_00248_23H5VFLT4_s01_2																																																		74.6%	54%	151bp	151bp	18%	308.1M
tih_rna_sample_00248_23H5VFLT4_s01_trimmed_1																																																		74.9%	54%	127bp	137bp	18%	296.9M	74.9%	54%	127bp	137bp	18%	296.9M
tih_rna_sample_00248_23H5VFLT4_s01_trimmed_2																																																		75.1%	54%	127bp	137bp	9%	296.9M	75.1%	54%	127bp	137bp	9%	296.9M
tih_rna_sample_00251_23H5VFLT4_s03	9999000000	305618162	570116642	0.8475	142.0bp	132.0bp	0.27%	1.06%	0.35%	0.00%	0.59%	3.29%	0.56%	0.00%	0.05	593134676	0.01%	0.54%	274926770	0.81%	0.83%	0.18%	0.17%	221657383	112064931	49786669	23263664	419.89	197.00	0.73%	0.61%	0.98	0.000	No	0.00%				54.0%	86.4%	95.2%	282.3M	37.3%	97.7%	74951.0Mb	593.1M	54.6%	98.9%	57.3%
tih_rna_sample_00251_23H5VFLT4_s03_1																																				142.0bp	90.9%	269.6M												79.2%	53%	151bp	151bp	27%	341.0M
tih_rna_sample_00251_23H5VFLT4_s03_2																																																		78.7%	54%	151bp	151bp	18%	341.0M
tih_rna_sample_00251_23H5VFLT4_s03_trimmed_1																																																		78.1%	54%	129bp	142bp	18%	296.6M	78.1%	54%	129bp	142bp	18%	296.6M
tih_rna_sample_00251_23H5VFLT4_s03_trimmed_2																																																		78.5%	54%	129bp	142bp	9%	296.6M	78.5%	54%	129bp	142bp	9%	296.6M
tih_rna_sample_00252_23H5VFLT4_s04	9990000000	242978100	574001167	0.8713	146.1bp	136.0bp	0.07%	0.60%	0.31%	0.00%	0.15%	1.89%	0.47%	0.00%	0.06	592807726	0.01%	0.60%	239138557	0.82%	0.85%	0.16%	0.15%	196648972	99567401	39110829	17916545	376.96	200.00	0.75%	0.62%	0.98	0.000	Yes	0.00%				60.0%	88.8%	95.8%	283.9M	41.5%	97.6%	75841.9Mb	592.8M	55.1%	98.8%	54.5%
tih_rna_sample_00252_23H5VFLT4_s04_1																																				146.1bp	92.8%	275.0M												79.0%	54%	151bp	151bp	27%	311.5M
tih_rna_sample_00252_23H5VFLT4_s04_2																																																		78.0%	55%	151bp	151bp	18%	311.5M
tih_rna_sample_00252_23H5VFLT4_s04_trimmed_1																																																		78.7%	54%	131bp	142bp	18%	296.4M	78.7%	54%	131bp	142bp	18%	296.4M
tih_rna_sample_00252_23H5VFLT4_s04_trimmed_2																																																		78.4%	55%	131bp	142bp	9%	296.4M	78.4%	55%	131bp	142bp	9%	296.4M
tih_rna_sample_00254_23H5VFLT4_s05	9999000000	241418359	561168067	0.7501	125.6bp	119.0bp	0.43%	0.87%	0.50%	0.00%	0.90%	2.55%	0.73%	0.00%	0.02	591847760	0.01%	0.60%	237204622	0.85%	0.88%	0.13%	0.12%	201763414	101696886	30754802	14175235	343.33	143.00	0.70%	0.56%	0.98	0.000	No	0.00%				60.4%	82.7%	93.6%	276.9M	35.4%	97.5%	70175.8Mb	591.8M	58.3%	98.6%	70.9%
tih_rna_sample_00254_23H5VFLT4_s05_1																																				125.6bp	94.4%	279.3M												81.0%	56%	151bp	151bp	27%	376.5M
tih_rna_sample_00254_23H5VFLT4_s05_2																																																		80.5%	57%	151bp	151bp	18%	376.5M
tih_rna_sample_00254_23H5VFLT4_s05_trimmed_1																																																		79.0%	58%	122bp	127bp	18%	295.9M	79.0%	58%	122bp	127bp	18%	295.9M
tih_rna_sample_00254_23H5VFLT4_s05_trimmed_2																																																		79.4%	58%	122bp	127bp	9%	295.9M	79.4%	58%	122bp	127bp	9%	295.9M
tih_rna_sample_00261_23H5VFLT4_s06	9999000000	250304600	550039650	0.8585	140.4bp	132.0bp	0.14%	0.39%	0.24%	0.00%	0.32%	1.30%	0.39%	0.00%	0.07	574713108	0.01%	0.62%	220824058	0.77%	0.80%	0.21%	0.20%	169830567	85856218	46814183	22036109	314.39	152.00	0.73%	0.58%	0.97	0.000	No	0.00%				62.0%	84.6%	94.7%	272.2M	41.7%	97.3%	72197.8Mb	574.7M	56.7%	98.7%	58.3%
tih_rna_sample_00261_23H5VFLT4_s06_1																																				140.4bp	90.8%	261.0M												78.4%	55%	151bp	151bp	27%	291.1M
tih_rna_sample_00261_23H5VFLT4_s06_2																																																		77.8%	56%	151bp	151bp	18%	291.1M
tih_rna_sample_00261_23H5VFLT4_s06_trimmed_1																																																		78.6%	56%	129bp	137bp	18%	287.4M	78.6%	56%	129bp	137bp	18%	287.4M
tih_rna_sample_00261_23H5VFLT4_s06_trimmed_2																																																		78.6%	56%	129bp	142bp	9%	287.4M	78.6%	56%	129bp	142bp	9%	287.4M
tih_rna_sample_00272_23H5VFLT4_s09	9999000000	342603611	577174484	0.8514	142.7bp	133.0bp	0.22%	0.47%	0.28%	0.00%	0.48%	1.54%	0.44%	0.00%	0.06	593774488	0.01%	0.51%	290007094	0.85%	0.87%	0.14%	0.13%	246753217	124740809	40276909	18392451	477.36	247.00	0.76%	0.64%	0.98	0.000	No	0.00%				51.4%	89.9%	96.2%	285.6M	35.4%	97.7%	75595.7Mb	593.8M	54.6%	99.0%	55.6%
tih_rna_sample_00272_23H5VFLT4_s09_1																																				142.7bp	93.1%	276.5M												79.8%	53%	151bp	151bp	27%	360.8M
tih_rna_sample_00272_23H5VFLT4_s09_2																																																		79.2%	54%	151bp	151bp	18%	360.8M
tih_rna_sample_00272_23H5VFLT4_s09_trimmed_1																																																		78.4%	54%	130bp	142bp	18%	296.9M	78.4%	54%	130bp	142bp	18%	296.9M
tih_rna_sample_00272_23H5VFLT4_s09_trimmed_2																																																		78.6%	54%	130bp	142bp	9%	296.9M	78.6%	54%	130bp	142bp	9%	296.9M
tih_rna_sample_00274_23H5VFLT4_s14	9999000000	190118129	376601357	0.8686	119.6bp	115.0bp	0.10%	0.79%	0.34%	0.00%	0.21%	2.42%	0.49%	0.00%	0.13	392539082	0.01%	0.60%	156976267	0.68%	0.70%	0.31%	0.30%	106202235	53492869	47899095	23352836	165.43	82.00	0.66%	0.46%	0.98	0.000	No	0.00%				60.5%	84.3%	94.5%	185.4M	35.3%	97.6%	45108.4Mb	392.5M	53.3%	98.7%	77.0%
tih_rna_sample_00274_23H5VFLT4_s14_1																																				119.6bp	87.0%	170.8M												72.3%	52%	151bp	151bp	27%	198.8M
tih_rna_sample_00274_23H5VFLT4_s14_2																																																		70.8%	53%	151bp	151bp	36%	198.8M
tih_rna_sample_00274_23H5VFLT4_s14_trimmed_1																																																		72.4%	53%	118bp	117bp	18%	196.3M	72.4%	53%	118bp	117bp	18%	196.3M
tih_rna_sample_00274_23H5VFLT4_s14_trimmed_2																																																		71.5%	53%	118bp	122bp	9%	196.3M	71.5%	53%	118bp	122bp	9%	196.3M
tih_rna_sample_00280_23H5VFLT4_s18	9999000000	459893951	569188144	0.9184	156.7bp	144.0bp	0.13%	0.52%	0.44%	0.00%	0.29%	1.62%	0.66%	0.00%	5.92	594199186	0.01%	0.44%	330974763	0.89%	0.91%	0.10%	0.09%	292934305	148424420	34164570	14646841	605.71	281.00	0.74%	0.64%	0.98	0.000	No	0.00%				44.6%	86.6%	94.9%	281.9M	31.8%	97.7%	77998.6Mb	594.2M	55.5%	99.0%	47.2%
tih_rna_sample_00280_23H5VFLT4_s18_1																																				156.7bp	94.2%	279.9M												81.3%	54%	151bp	151bp	27%	453.4M
tih_rna_sample_00280_23H5VFLT4_s18_2																																																		81.2%	55%	151bp	151bp	18%	453.4M
tih_rna_sample_00280_23H5VFLT4_s18_trimmed_1																																																		78.3%	55%	134bp	151bp	18%	297.1M	78.3%	55%	134bp	151bp	18%	297.1M
tih_rna_sample_00280_23H5VFLT4_s18_trimmed_2																																																		79.0%	55%	134bp	151bp	9%	297.1M	79.0%	55%	134bp	151bp	9%	297.1M
tih_rna_sample_00377_23H5VFLT4_s23	9999000000	269725413	568760257	0.8197	139.3bp	129.0bp	0.16%	0.59%	0.36%	0.00%	0.38%	1.84%	0.55%	0.00%	5.31	593411874	0.01%	0.58%	248620551	0.86%	0.89%	0.12%	0.11%	214093586	108332932	30707771	13692658	405.18	178.00	0.72%	0.59%	0.98	0.000	No	0.00%				58.5%	84.2%	94.3%	279.9M	37.6%	97.7%	74650.0Mb	593.4M	54.6%	98.9%	58.9%
tih_rna_sample_00377_23H5VFLT4_s23_1																																				139.3bp	94.5%	280.5M												82.7%	53%	151bp	151bp	27%	408.3M
tih_rna_sample_00377_23H5VFLT4_s23_2																																																		80.7%	54%	151bp	151bp	27%	408.3M
tih_rna_sample_00377_23H5VFLT4_s23_trimmed_1																																																		80.3%	54%	129bp	137bp	18%	296.7M	80.3%	54%	129bp	137bp	18%	296.7M
tih_rna_sample_00377_23H5VFLT4_s23_trimmed_2																																																		79.0%	54%	129bp	137bp	18%	296.7M	79.0%	54%	129bp	137bp	18%	296.7M
tih_rna_sample_00378_23H5VFLT4_s24	9999000000	210188740	337674527	0.8708	118.8bp	113.0bp	0.22%	2.05%	0.61%	0.00%	0.39%	5.47%	0.81%	0.00%	0.08	351290946	0.01%	0.52%	169080437	0.75%	0.76%	0.24%	0.24%	126355247	63660047	40496204	19583850	198.43	98.00	0.67%	0.50%	0.98	0.000	No	0.00%				52.2%	84.8%	94.7%	166.4M	29.6%	97.8%	40083.7Mb	351.3M	50.8%	98.9%	77.4%
tih_rna_sample_00378_23H5VFLT4_s24_1																																				118.8bp	88.1%	154.8M												71.4%	50%	151bp	151bp	27%	177.5M
tih_rna_sample_00378_23H5VFLT4_s24_2																																																		69.8%	51%	151bp	151bp	36%	177.5M
tih_rna_sample_00378_23H5VFLT4_s24_trimmed_1																																																		71.4%	50%	117bp	117bp	18%	175.6M	71.4%	50%	117bp	117bp	18%	175.6M
tih_rna_sample_00378_23H5VFLT4_s24_trimmed_2																																																		70.4%	50%	117bp	117bp	9%	175.6M	70.4%	50%	117bp	117bp	9%	175.6M
tih_rna_sample_00388_23H5VFLT4_s22	9999000000	466249784	578539185	0.8972	164.0bp	151.0bp	0.13%	0.56%	0.36%	0.00%	0.29%	1.93%	0.57%	0.00%	0.04	594456558	0.00%	0.45%	327080551	0.88%	0.91%	0.11%	0.09%	289212101	146753224	35075564	14902809	621.59	327.00	0.78%	0.68%	0.98	0.000	No	0.00%				45.2%	90.4%	96.4%	286.5M	33.1%	97.6%	79462.6Mb	594.5M	54.7%	99.1%	41.3%
tih_rna_sample_00388_23H5VFLT4_s22_1																																				164.0bp	94.2%	280.0M												82.6%	54%	151bp	151bp	27%	549.5M
tih_rna_sample_00388_23H5VFLT4_s22_2																																																		82.1%	54%	151bp	151bp	18%	549.5M
tih_rna_sample_00388_23H5VFLT4_s22_trimmed_1																																																		78.5%	54%	137bp	151bp	18%	297.2M	78.5%	54%	137bp	151bp	18%	297.2M
tih_rna_sample_00388_23H5VFLT4_s22_trimmed_2																																																		78.6%	54%	137bp	151bp	9%	297.2M	78.6%	54%	137bp	151bp	9%	297.2M
tih_rna_sample_00394_23H5VFLT4_s25	9999000000	198626534	370238880	0.8892	126.3bp	119.0bp	0.17%	0.53%	0.28%	0.00%	0.40%	1.73%	0.43%	0.00%	4.87	386626392	0.01%	0.58%	162730870	0.71%	0.73%	0.27%	0.27%	115428839	58147876	44055905	21374528	191.37	94.00	0.67%	0.49%	0.98	0.000	No	0.00%				58.4%	84.7%	94.7%	183.1M	36.0%	97.6%	45626.0Mb	386.6M	53.8%	98.7%	71.4%
tih_rna_sample_00394_23H5VFLT4_s25_1																																				126.3bp	87.8%	169.7M												73.1%	53%	151bp	151bp	27%	195.8M
tih_rna_sample_00394_23H5VFLT4_s25_2																																																		72.1%	53%	151bp	151bp	36%	195.8M
tih_rna_sample_00394_23H5VFLT4_s25_trimmed_1																																																		73.2%	53%	121bp	122bp	18%	193.3M	73.2%	53%	121bp	122bp	18%	193.3M
tih_rna_sample_00394_23H5VFLT4_s25_trimmed_2																																																		72.9%	53%	121bp	122bp	9%	193.3M	72.9%	53%	121bp	122bp	9%	193.3M
tih_rna_sample_00396_23H5VFLT4_s26	9999000000	517451637	574139273	0.8875	155.8bp	144.0bp	0.31%	1.00%	0.43%	0.00%	0.69%	3.09%	0.64%	0.00%	0.04	594249644	0.01%	0.41%	348395334	0.87%	0.89%	0.12%	0.11%	303793174	153973379	41391222	18137271	630.86	334.00	0.75%	0.66%	0.98	0.000	No	0.00%				41.6%	89.0%	95.8%	284.5M	29.1%	97.7%	78149.3Mb	594.2M	54.1%	99.0%	46.6%
tih_rna_sample_00396_23H5VFLT4_s26_1																																				155.8bp	93.2%	277.0M												79.6%	53%	151bp	151bp	27%	423.6M
tih_rna_sample_00396_23H5VFLT4_s26_2																																																		79.2%	54%	151bp	151bp	18%	423.6M
tih_rna_sample_00396_23H5VFLT4_s26_trimmed_1																																																		77.0%	53%	135bp	151bp	18%	297.1M	77.0%	53%	135bp	151bp	18%	297.1M
tih_rna_sample_00396_23H5VFLT4_s26_trimmed_2																																																		77.2%	54%	135bp	151bp	9%	297.1M	77.2%	54%	135bp	151bp	9%	297.1M
tih_rna_sample_00400_23H5VFLT4_s27	9999000000	368397903	568270409	0.8552	131.3bp	124.0bp	0.20%	0.70%	0.38%	0.00%	0.42%	2.10%	0.56%	0.00%	5.60	593346640	0.01%	0.50%	298937124	0.85%	0.88%	0.13%	0.12%	255402144	128820976	39760617	18386662	465.03	244.00	0.76%	0.65%	0.98	0.000	Yes	0.00%				49.9%	86.1%	94.8%	281.2M	31.1%	97.7%	72529.2Mb	593.3M	54.1%	98.9%	64.2%
tih_rna_sample_00400_23H5VFLT4_s27_1																																				131.3bp	93.4%	277.0M												80.1%	53%	151bp	151bp	27%	415.5M
tih_rna_sample_00400_23H5VFLT4_s27_2																																																		79.4%	54%	151bp	151bp	18%	415.5M
tih_rna_sample_00400_23H5VFLT4_s27_trimmed_1																																																		77.5%	53%	125bp	132bp	18%	296.7M	77.5%	53%	125bp	132bp	18%	296.7M
tih_rna_sample_00400_23H5VFLT4_s27_trimmed_2																																																		77.4%	54%	125bp	132bp	9%	296.7M	77.4%	54%	125bp	132bp	9%	296.7M
tih_rna_sample_00402_23H5VFLT4_s28	9999000000	496137382	572679083	0.9103	143.0bp	133.0bp	0.20%	1.12%	0.33%	0.00%	0.44%	3.55%	0.52%	0.00%	0.04	594588604	0.01%	0.44%	330414013	0.85%	0.87%	0.14%	0.13%	281227425	142157658	45917720	21029946	542.83	289.00	0.77%	0.66%	0.98	0.000	Yes	0.00%				44.7%	88.0%	95.3%	283.2M	29.1%	97.6%	75250.9Mb	594.6M	53.1%	99.1%	56.6%
tih_rna_sample_00402_23H5VFLT4_s28_1																																				143.0bp	92.5%	274.9M												78.7%	52%	151bp	151bp	27%	395.4M
tih_rna_sample_00402_23H5VFLT4_s28_2																																																		78.3%	53%	151bp	151bp	18%	395.4M
tih_rna_sample_00402_23H5VFLT4_s28_trimmed_1																																																		76.6%	52%	130bp	142bp	18%	297.3M	76.6%	52%	130bp	142bp	18%	297.3M
tih_rna_sample_00402_23H5VFLT4_s28_trimmed_2																																																		76.9%	53%	130bp	142bp	9%	297.3M	76.9%	53%	130bp	142bp	9%	297.3M
tih_rna_sample_00403_23H5VFLT4_s29	9999000000	304504091	576157495	0.8779	132.8bp	124.0bp	0.19%	0.63%	0.36%	0.00%	0.41%	1.97%	0.52%	0.00%	6.50	593775110	0.01%	0.54%	271917188	0.81%	0.84%	0.17%	0.16%	221393725	111810853	46895155	21990043	396.80	186.00	0.74%	0.61%	0.98	0.000	No	0.00%				54.5%	89.2%	95.8%	284.6M	34.7%	97.7%	72689.7Mb	593.8M	53.9%	99.0%	64.2%
tih_rna_sample_00403_23H5VFLT4_s29_1																																				132.8bp	91.5%	271.7M												77.7%	53%	151bp	151bp	27%	323.0M
tih_rna_sample_00403_23H5VFLT4_s29_2																																																		76.9%	53%	151bp	151bp	18%	323.0M
tih_rna_sample_00403_23H5VFLT4_s29_trimmed_1																																																		77.2%	53%	125bp	132bp	18%	296.9M	77.2%	53%	125bp	132bp	18%	296.9M
tih_rna_sample_00403_23H5VFLT4_s29_trimmed_2																																																		77.0%	54%	125bp	132bp	9%	296.9M	77.0%	54%	125bp	132bp	9%	296.9M
tih_rna_sample_00407_23H5VFLT4_s33	9990000000	159526493	545503337	0.8811	141.6bp	131.0bp	0.12%	0.52%	0.36%	0.00%	0.26%	1.64%	0.54%	0.00%	0.04	568787934	0.01%	0.71%	163235783	0.76%	0.79%	0.21%	0.21%	124343412	62917849	34655631	16246801	230.07	111.00	0.70%	0.52%	0.98	0.000	No	0.00%				71.8%	86.2%	95.0%	270.2M	50.3%	97.5%	71694.5Mb	568.8M	56.9%	98.7%	57.0%
tih_rna_sample_00407_23H5VFLT4_s33_1																																				141.6bp	92.3%	262.5M												83.1%	55%	151bp	151bp	27%	288.2M
tih_rna_sample_00407_23H5VFLT4_s33_2																																																		82.0%	56%	151bp	151bp	18%	288.2M
tih_rna_sample_00407_23H5VFLT4_s33_trimmed_1																																																		83.3%	56%	129bp	142bp	18%	284.4M	83.3%	56%	129bp	142bp	18%	284.4M
tih_rna_sample_00407_23H5VFLT4_s33_trimmed_2																																																		83.1%	57%	129bp	142bp	9%	284.4M	83.1%	57%	129bp	142bp	9%	284.4M
tih_rna_sample_00410_23H5VFLT4_s34	9999000000	177363137	530341840	0.8870	132.2bp	124.0bp	0.05%	0.76%	0.40%	0.00%	0.10%	2.30%	0.60%	0.00%	0.05	551546748	0.01%	0.69%	172422442	0.71%	0.74%	0.26%	0.26%	122934710	62052737	45678563	21953944	209.80	101.00	0.67%	0.50%	0.98	0.000	No	0.00%				69.2%	86.3%	95.1%	262.2M	46.4%	97.6%	67127.2Mb	551.5M	53.2%	98.6%	66.2%
tih_rna_sample_00410_23H5VFLT4_s34_1																																				132.2bp	90.6%	249.8M												79.5%	52%	151bp	151bp	27%	279.8M
tih_rna_sample_00410_23H5VFLT4_s34_2																																																		78.8%	53%	151bp	151bp	18%	279.8M
tih_rna_sample_00410_23H5VFLT4_s34_trimmed_1																																																		79.6%	53%	125bp	132bp	18%	275.8M	79.6%	53%	125bp	132bp	18%	275.8M
tih_rna_sample_00410_23H5VFLT4_s34_trimmed_2																																																		79.7%	53%	125bp	132bp	9%	275.8M	79.7%	53%	125bp	132bp	9%	275.8M
tih_rna_sample_00414_23H5VFLT4_s40	9990000000	430530897	569443088	0.9344	147.6bp	136.0bp	0.10%	0.76%	0.38%	0.00%	0.21%	2.35%	0.58%	0.00%	5.93	593682380	0.01%	0.45%	324525906	0.86%	0.88%	0.13%	0.12%	277751836	140537932	42628037	19183451	542.83	265.00	0.76%	0.65%	0.98	0.000	Yes	0.00%				45.7%	87.0%	95.0%	281.9M	31.4%	97.7%	75747.7Mb	593.7M	56.3%	98.9%	54.1%
tih_rna_sample_00414_23H5VFLT4_s40_1																																				147.6bp	92.5%	274.6M												79.4%	55%	151bp	151bp	27%	364.3M
tih_rna_sample_00414_23H5VFLT4_s40_2																																																		79.5%	56%	151bp	151bp	18%	364.3M
tih_rna_sample_00414_23H5VFLT4_s40_trimmed_1																																																		77.9%	56%	131bp	142bp	18%	296.8M	77.9%	56%	131bp	142bp	18%	296.8M
tih_rna_sample_00414_23H5VFLT4_s40_trimmed_2																																																		78.7%	56%	131bp	147bp	9%	296.8M	78.7%	56%	131bp	147bp	9%	296.8M
tih_rna_sample_00419_23H5VFLT4_s44	9990000000	448556434	573585445	0.9078	147.8bp	135.0bp	0.23%	1.09%	0.49%	0.00%	0.50%	3.28%	0.72%	0.00%	5.14	593447468	0.00%	0.44%	331327275	0.88%	0.90%	0.11%	0.10%	290778799	147140715	37689982	16597433	578.34	274.00	0.73%	0.63%	0.98	0.000	Yes	0.00%				44.4%	88.7%	95.8%	284.3M	29.8%	97.7%	76026.0Mb	593.4M	54.7%	98.9%	52.5%
tih_rna_sample_00419_23H5VFLT4_s44_1																																				147.8bp	93.9%	278.7M												80.4%	54%	151bp	151bp	27%	434.5M
tih_rna_sample_00419_23H5VFLT4_s44_2																																																		80.2%	54%	151bp	151bp	18%	434.5M
tih_rna_sample_00419_23H5VFLT4_s44_trimmed_1																																																		77.6%	54%	131bp	147bp	18%	296.7M	77.6%	54%	131bp	147bp	18%	296.7M
tih_rna_sample_00419_23H5VFLT4_s44_trimmed_2																																																		78.2%	54%	131bp	147bp	9%	296.7M	78.2%	54%	131bp	147bp	9%	296.7M
tih_rna_sample_00420_23H5VFLT4_s45	9999000000	108401346	372125744	0.9382	136.9bp	127.0bp	0.11%	0.28%	0.20%	0.00%	0.23%	0.92%	0.32%	0.00%	6.06	389910420	0.01%	0.76%	93098276	0.62%	0.65%	0.35%	0.35%	57320191	28992777	32567328	15723102	99.71	48.00	0.59%	0.31%	0.98	0.000	No	0.00%				76.8%	84.9%	94.6%	184.4M	53.4%	97.5%	48206.7Mb	389.9M	55.7%	98.3%	61.5%
tih_rna_sample_00420_23H5VFLT4_s45_1																																				136.9bp	89.9%	175.2M												82.0%	55%	151bp	151bp	27%	198.4M
tih_rna_sample_00420_23H5VFLT4_s45_2																																																		80.3%	55%	151bp	151bp	18%	198.4M
tih_rna_sample_00420_23H5VFLT4_s45_trimmed_1																																																		82.1%	55%	127bp	137bp	18%	195.0M	82.1%	55%	127bp	137bp	18%	195.0M
tih_rna_sample_00420_23H5VFLT4_s45_trimmed_2																																																		81.3%	55%	127bp	137bp	9%	195.0M	81.3%	55%	127bp	137bp	9%	195.0M
tih_rna_sample_00422_23H5VFLT4_s47	9999000000	61455637	158673388	0.9040	109.1bp	104.0bp	0.46%	0.94%	0.35%	0.00%	0.94%	2.84%	0.52%	0.00%	5.94	169264240	0.01%	0.73%	45174579	0.50%	0.52%	0.46%	0.48%	22455775	11282989	20740848	10235737	30.65	12.00	0.29%	0.06%	0.98	0.000	No	0.00%				74.2%	78.3%	92.6%	78.4M	40.1%	97.5%	17953.5Mb	169.3M	54.5%	97.0%	84.7%
tih_rna_sample_00422_23H5VFLT4_s47_1																																				109.1bp	85.4%	72.3M												75.9%	53%	151bp	151bp	27%	87.2M
tih_rna_sample_00422_23H5VFLT4_s47_2																																																		74.5%	55%	151bp	151bp	45%	87.2M
tih_rna_sample_00422_23H5VFLT4_s47_trimmed_1																																																		75.6%	54%	109bp	107bp	18%	84.6M	75.6%	54%	109bp	107bp	18%	84.6M
tih_rna_sample_00422_23H5VFLT4_s47_trimmed_2																																																		75.1%	54%	109bp	107bp	9%	84.6M	75.1%	54%	109bp	107bp	9%	84.6M
tih_rna_sample_00425_23H5VFLT4_s46	9990000000	146416358	442167034	0.8813	124.9bp	118.0bp	0.07%	0.53%	0.21%	0.00%	0.17%	1.79%	0.36%	0.00%	0.10	464587216	0.01%	0.71%	133728172	0.62%	0.65%	0.34%	0.35%	83527122	42062134	45710358	22307382	134.23	62.00	0.63%	0.39%	0.98	0.000	No	0.00%				71.9%	83.2%	94.2%	218.9M	45.3%	97.4%	54356.8Mb	464.6M	56.7%	98.2%	72.4%
tih_rna_sample_00425_23H5VFLT4_s46_1																																				124.9bp	88.3%	205.2M												79.9%	55%	151bp	151bp	27%	236.4M
tih_rna_sample_00425_23H5VFLT4_s46_2																																																		78.3%	56%	151bp	151bp	18%	236.4M
tih_rna_sample_00425_23H5VFLT4_s46_trimmed_1																																																		79.9%	56%	120bp	122bp	18%	232.3M	79.9%	56%	120bp	122bp	18%	232.3M
tih_rna_sample_00425_23H5VFLT4_s46_trimmed_2																																																		79.3%	56%	120bp	122bp	9%	232.3M	79.3%	56%	120bp	122bp	9%	232.3M
tih_rna_sample_00426_23H5VFLT4_s48	9999000000	193132951	536156844	0.8921	141.8bp	132.0bp	0.22%	0.91%	0.27%	0.00%	0.46%	2.78%	0.44%	0.00%	5.98	574610528	0.01%	0.65%	200940478	0.79%	0.82%	0.18%	0.18%	158783184	80343547	37116244	17142577	296.20	121.00	0.68%	0.53%	0.98	0.000	No	0.00%				65.6%	77.1%	92.5%	265.8M	44.9%	97.4%	72397.7Mb	574.6M	58.4%	98.3%	56.5%
tih_rna_sample_00426_23H5VFLT4_s48_1																																				141.8bp	91.5%	262.8M												81.9%	57%	151bp	151bp	27%	292.3M
tih_rna_sample_00426_23H5VFLT4_s48_2																																																		80.7%	57%	151bp	151bp	18%	292.3M
tih_rna_sample_00426_23H5VFLT4_s48_trimmed_1																																																		82.1%	58%	129bp	142bp	18%	287.3M	82.1%	58%	129bp	142bp	18%	287.3M
tih_rna_sample_00426_23H5VFLT4_s48_trimmed_2																																																		82.0%	58%	129bp	142bp	9%	287.3M	82.0%	58%	129bp	142bp	9%	287.3M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
GM24385_0001_RNA_0001_23H5VFLT4_s08	657.8M	0.0M	0.0M	85.0M	5.6M	539.7M	270.0M	269.7M	269.9M	269.8M	325.4M	214.2M	538.0M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s16	657.3M	0.0M	0.0M	78.5M	5.6M	547.0M	273.7M	273.3M	273.5M	273.5M	326.5M	220.5M	545.2M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s24	524.2M	0.0M	0.0M	61.3M	4.6M	437.8M	219.0M	218.7M	218.9M	218.9M	264.6M	173.1M	436.4M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s32	528.8M	0.0M	0.0M	67.9M	4.6M	434.3M	217.3M	217.0M	217.2M	217.1M	266.8M	167.5M	433.1M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s40	571.9M	0.0M	0.0M	63.8M	4.7M	482.0M	241.1M	240.9M	241.0M	241.0M	296.3M	185.7M	480.7M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48	488.0M	0.0M	0.0M	60.3M	4.2M	403.5M	201.9M	201.6M	201.8M	201.7M	246.4M	157.1M	402.4M	0.0M
HD789_0002_RNA_0008_23H5VFLT4_s19	637.9M	0.0M	0.0M	42.4M	2.5M	575.9M	288.1M	287.8M	288.0M	288.0M	280.6M	295.4M	574.3M	0.0M
NTC_0001_0001_23H5VFLT4_s15	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
V4_0001_RNA_0001_23H5VFLT4_s13	641.3M	0.0M	0.0M	45.2M	3.1M	574.6M	287.4M	287.2M	287.3M	287.3M	287.5M	287.1M	572.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s01	656.6M	0.0M	0.0M	66.2M	3.9M	562.9M	281.6M	281.3M	281.5M	281.4M	303.6M	259.3M	560.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s02	655.8M	0.0M	0.0M	65.2M	4.2M	563.3M	281.8M	281.5M	281.7M	281.6M	310.9M	252.5M	561.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s03	662.3M	0.0M	0.0M	71.8M	4.5M	561.4M	280.8M	280.6M	280.7M	280.7M	314.1M	247.3M	559.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s04	664.2M	0.0M	0.0M	74.6M	4.9M	559.5M	279.9M	279.6M	279.8M	279.7M	320.8M	238.7M	557.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s05	674.5M	0.0M	0.0M	85.6M	5.4M	555.9M	278.0M	277.8M	277.9M	277.9M	327.4M	228.5M	554.1M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s06	669.6M	0.0M	0.0M	80.6M	5.4M	557.2M	278.7M	278.5M	278.6M	278.6M	329.5M	227.6M	555.3M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s07	597.6M	0.0M	0.0M	87.6M	5.6M	476.9M	238.6M	238.3M	238.4M	238.4M	292.2M	184.7M	475.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s09	646.1M	0.0M	0.0M	54.2M	3.5M	567.8M	284.1M	283.8M	283.9M	283.9M	299.0M	268.8M	566.1M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s10	649.2M	0.0M	0.0M	58.2M	3.9M	565.7M	283.0M	282.7M	282.9M	282.9M	303.9M	261.8M	563.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s11	626.6M	0.0M	0.0M	60.7M	4.1M	540.1M	270.2M	269.9M	270.1M	270.0M	297.2M	242.9M	538.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s12	662.7M	0.0M	0.0M	73.2M	5.0M	559.5M	279.9M	279.6M	279.8M	279.8M	321.2M	238.3M	557.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s13	660.9M	0.0M	0.0M	70.4M	5.1M	560.9M	280.6M	280.3M	280.5M	280.4M	322.5M	238.4M	559.1M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s14	664.7M	0.0M	0.0M	74.1M	5.3M	560.3M	280.3M	280.0M	280.2M	280.1M	326.4M	233.9M	558.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s15	626.6M	0.0M	0.0M	69.9M	5.0M	527.9M	264.1M	263.8M	263.9M	263.9M	308.8M	219.1M	526.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s17	643.4M	0.0M	0.0M	52.0M	3.4M	568.2M	284.2M	284.0M	284.1M	284.1M	298.5M	269.7M	566.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s18	650.4M	0.0M	0.0M	60.8M	4.0M	563.8M	282.0M	281.8M	281.9M	281.9M	304.6M	259.1M	561.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s19	656.7M	0.0M	0.0M	65.4M	4.5M	563.7M	282.0M	281.7M	281.9M	281.9M	312.4M	251.3M	562.0M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s20	665.8M	0.0M	0.0M	76.0M	5.0M	559.4M	279.9M	279.5M	279.7M	279.7M	319.0M	240.4M	557.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s21	666.1M	0.0M	0.0M	80.1M	5.2M	554.7M	277.5M	277.2M	277.4M	277.3M	322.2M	232.5M	552.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s22	578.2M	0.0M	0.0M	65.6M	4.7M	485.8M	243.1M	242.8M	242.9M	242.9M	284.6M	201.2M	484.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s23	652.1M	0.0M	0.0M	77.5M	5.4M	543.4M	271.8M	271.5M	271.7M	271.7M	320.6M	222.8M	541.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s25	646.1M	0.0M	0.0M	55.9M	3.6M	565.8M	283.0M	282.8M	282.9M	282.9M	300.6M	265.2M	564.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s26	646.9M	0.0M	0.0M	59.9M	4.0M	561.3M	280.8M	280.5M	280.7M	280.6M	303.4M	257.8M	559.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s27	652.7M	0.0M	0.0M	63.7M	4.4M	561.9M	281.1M	280.8M	281.0M	280.9M	311.0M	250.9M	560.1M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s28	531.2M	0.0M	0.0M	59.4M	3.9M	447.9M	224.1M	223.9M	224.0M	224.0M	256.4M	191.6M	446.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s29	654.4M	0.0M	0.0M	67.0M	4.9M	559.1M	279.7M	279.4M	279.5M	279.5M	326.3M	232.8M	557.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s30	546.3M	0.0M	0.0M	63.2M	4.3M	457.8M	229.0M	228.8M	228.9M	228.9M	270.4M	187.4M	456.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s31	663.5M	0.0M	0.0M	75.6M	5.2M	557.5M	278.9M	278.6M	278.8M	278.8M	328.1M	229.4M	555.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s33	643.7M	0.0M	0.0M	53.8M	3.5M	565.9M	283.1M	282.8M	283.0M	282.9M	302.5M	263.4M	564.3M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s34	646.9M	0.0M	0.0M	60.0M	4.1M	561.1M	280.7M	280.4M	280.6M	280.5M	305.1M	256.0M	559.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s35	520.0M	0.0M	0.0M	55.1M	3.6M	442.2M	221.2M	221.0M	221.1M	221.1M	246.8M	195.4M	440.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s36	623.6M	0.0M	0.0M	64.0M	4.6M	532.7M	266.5M	266.2M	266.4M	266.3M	306.0M	226.7M	531.0M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s37	612.0M	0.0M	0.0M	64.5M	4.7M	520.5M	260.4M	260.1M	260.3M	260.2M	304.8M	215.7M	518.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s38	602.7M	0.0M	0.0M	72.3M	5.1M	501.4M	250.8M	250.6M	250.7M	250.7M	298.8M	202.6M	500.0M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s39	559.5M	0.0M	0.0M	62.8M	4.6M	470.9M	235.6M	235.3M	235.4M	235.4M	279.4M	191.4M	469.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s41	645.6M	0.0M	0.0M	56.3M	3.5M	564.3M	282.3M	282.0M	282.1M	282.1M	303.5M	260.8M	562.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s42	648.3M	0.0M	0.0M	59.5M	4.1M	562.7M	281.5M	281.2M	281.4M	281.4M	306.7M	256.1M	560.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s43	653.0M	0.0M	0.0M	64.7M	4.4M	560.7M	280.5M	280.2M	280.4M	280.3M	317.2M	243.5M	559.1M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s44	610.4M	0.0M	0.0M	67.5M	4.6M	515.3M	257.8M	257.5M	257.7M	257.6M	298.9M	216.4M	513.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s45	633.0M	0.0M	0.0M	73.2M	5.1M	530.2M	265.3M	265.0M	265.1M	265.1M	315.4M	214.9M	528.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s46	534.0M	0.0M	0.0M	62.8M	4.4M	445.7M	223.0M	222.7M	222.9M	222.8M	265.2M	180.5M	444.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s47	666.1M	0.0M	0.0M	81.0M	5.8M	552.6M	276.5M	276.2M	276.3M	276.3M	333.5M	219.1M	550.9M	0.0M
tih_rna_sample_00087_23H5VFLT4_s17	643.7M	0.0M	0.0M	46.3M	3.1M	575.0M	287.7M	287.3M	287.5M	287.5M	319.7M	255.3M	572.9M	0.0M
tih_rna_sample_00088_23H5VFLT4_s02	648.1M	0.0M	0.0M	52.7M	4.0M	573.3M	286.9M	286.5M	286.7M	286.6M	305.3M	268.0M	571.2M	0.0M
tih_rna_sample_00089_23H5VFLT4_s39	645.0M	0.0M	0.0M	48.6M	2.9M	574.9M	287.6M	287.3M	287.5M	287.4M	300.1M	274.8M	572.9M	0.0M
tih_rna_sample_00090_23H5VFLT4_s32	687.8M	0.0M	0.0M	92.1M	6.4M	559.0M	279.7M	279.3M	279.5M	279.5M	331.9M	227.1M	556.7M	0.0M
tih_rna_sample_00096_23H5VFLT4_s11	641.1M	0.0M	0.0M	44.4M	3.0M	576.6M	288.4M	288.1M	288.3M	288.3M	325.8M	250.8M	574.6M	0.0M
tih_rna_sample_00097_23H5VFLT4_s12	653.3M	0.0M	0.0M	56.0M	3.0M	573.3M	286.8M	286.5M	286.7M	286.6M	302.2M	271.1M	571.1M	0.0M
tih_rna_sample_00104_23H5VFLT4_s20	494.7M	0.0M	0.0M	77.7M	5.7M	389.1M	194.8M	194.3M	194.6M	194.5M	260.8M	128.3M	387.4M	0.0M
tih_rna_sample_00105_23H5VFLT4_s21	135.8M	0.0M	0.0M	24.7M	1.7M	102.5M	51.3M	51.2M	51.3M	51.2M	78.3M	24.2M	102.0M	0.0M
tih_rna_sample_00111_23H5VFLT4_s30	384.1M	0.0M	0.0M	45.0M	4.1M	320.9M	160.6M	160.3M	160.5M	160.5M	217.0M	103.9M	319.5M	0.0M
tih_rna_sample_00115_23H5VFLT4_s35	565.0M	0.0M	0.0M	64.6M	4.4M	476.0M	238.2M	237.7M	238.1M	237.9M	304.5M	171.5M	473.9M	0.0M
tih_rna_sample_00116_23H5VFLT4_s36	652.2M	0.0M	0.0M	56.2M	4.1M	571.7M	286.0M	285.7M	285.9M	285.8M	330.7M	241.0M	569.4M	0.0M
tih_rna_sample_00117_23H5VFLT4_s37	458.7M	0.0M	0.0M	42.2M	3.1M	398.4M	199.4M	199.1M	199.2M	199.2M	237.0M	161.5M	397.1M	0.0M
tih_rna_sample_00118_23H5VFLT4_s38	646.5M	0.0M	0.0M	50.4M	3.1M	574.3M	287.3M	287.0M	287.2M	287.1M	305.0M	269.3M	572.4M	0.0M
tih_rna_sample_00121_23H5VFLT4_s41	662.1M	0.0M	0.0M	66.2M	5.1M	568.6M	284.6M	284.0M	284.3M	284.3M	341.2M	227.4M	566.4M	0.0M
tih_rna_sample_00122_23H5VFLT4_s42	484.7M	0.0M	0.0M	57.9M	3.3M	405.2M	202.8M	202.4M	202.6M	202.6M	269.7M	135.5M	403.6M	0.0M
tih_rna_sample_00124_23H5VFLT4_s31	640.0M	0.0M	0.0M	43.2M	3.7M	576.2M	288.3M	287.9M	288.1M	288.1M	308.9M	267.3M	573.8M	0.0M
tih_rna_sample_00127_23H5VFLT4_s08	508.3M	0.0M	0.0M	48.9M	3.2M	440.1M	220.1M	220.0M	220.1M	220.0M	266.6M	173.5M	438.0M	0.0M
tih_rna_sample_00163_23H5VFLT4_s43	638.6M	0.0M	0.0M	42.2M	3.1M	576.1M	288.2M	287.9M	288.1M	288.0M	317.6M	258.5M	574.3M	0.0M
tih_rna_sample_00218_23H5VFLT4_s10	638.2M	0.0M	0.0M	40.7M	2.9M	578.4M	289.3M	289.0M	289.2M	289.2M	295.0M	283.4M	576.2M	0.0M
tih_rna_sample_00220_23H5VFLT4_s16	646.7M	0.0M	0.0M	49.8M	3.7M	575.6M	288.0M	287.6M	287.9M	287.8M	325.3M	250.4M	573.4M	0.0M
tih_rna_sample_00235_23H5VFLT4_s07	641.8M	0.0M	0.0M	44.6M	3.4M	576.9M	288.6M	288.3M	288.5M	288.4M	303.9M	273.1M	574.6M	0.0M
tih_rna_sample_00248_23H5VFLT4_s01	651.5M	0.0M	0.0M	54.6M	3.4M	573.2M	286.7M	286.4M	286.6M	286.6M	329.7M	243.4M	570.8M	0.0M
tih_rna_sample_00251_23H5VFLT4_s03	657.6M	0.0M	0.0M	61.9M	3.5M	570.1M	285.2M	284.9M	285.1M	285.1M	334.8M	235.3M	568.2M	0.0M
tih_rna_sample_00252_23H5VFLT4_s04	643.6M	0.0M	0.0M	48.0M	3.4M	574.0M	287.1M	286.9M	287.0M	287.0M	323.2M	250.8M	571.8M	0.0M
tih_rna_sample_00254_23H5VFLT4_s05	675.9M	0.0M	0.0M	80.7M	4.7M	561.2M	280.7M	280.5M	280.6M	280.6M	321.6M	239.6M	558.7M	0.0M
tih_rna_sample_00261_23H5VFLT4_s06	648.1M	0.0M	0.0M	70.8M	4.2M	550.0M	275.2M	274.9M	275.0M	275.0M	333.9M	216.2M	548.1M	0.0M
tih_rna_sample_00272_23H5VFLT4_s09	639.5M	0.0M	0.0M	43.2M	3.0M	577.2M	288.8M	288.4M	288.6M	288.6M	304.7M	272.5M	575.1M	0.0M
tih_rna_sample_00274_23H5VFLT4_s14	444.5M	0.0M	0.0M	49.1M	2.9M	376.6M	188.4M	188.2M	188.3M	188.3M	247.7M	128.9M	374.7M	0.0M
tih_rna_sample_00280_23H5VFLT4_s18	655.4M	0.0M	0.0M	58.7M	3.9M	569.2M	284.8M	284.4M	284.6M	284.6M	295.7M	273.5M	567.3M	0.0M
tih_rna_sample_00377_23H5VFLT4_s23	672.0M	0.0M	0.0M	74.2M	3.8M	568.8M	284.2M	284.6M	284.4M	284.3M	309.5M	259.3M	565.7M	0.0M
tih_rna_sample_00378_23H5VFLT4_s24	396.1M	0.0M	0.0M	42.4M	2.2M	337.7M	168.9M	168.8M	168.9M	168.8M	206.4M	131.3M	336.0M	0.0M
tih_rna_sample_00388_23H5VFLT4_s22	638.1M	0.0M	0.0M	41.3M	2.8M	578.5M	289.4M	289.1M	289.3M	289.2M	291.3M	287.3M	576.5M	0.0M
tih_rna_sample_00394_23H5VFLT4_s25	435.5M	0.0M	0.0M	46.9M	3.2M	370.2M	185.3M	184.9M	185.1M	185.1M	239.8M	130.4M	368.9M	0.0M
tih_rna_sample_00396_23H5VFLT4_s26	642.9M	0.0M	0.0M	46.4M	3.2M	574.1M	287.2M	286.9M	287.1M	287.1M	302.4M	271.7M	572.3M	0.0M
tih_rna_sample_00400_23H5VFLT4_s27	657.9M	0.0M	0.0M	61.8M	3.8M	568.3M	284.3M	284.0M	284.2M	284.1M	324.9M	243.3M	566.3M	0.0M
tih_rna_sample_00402_23H5VFLT4_s28	648.7M	0.0M	0.0M	51.3M	3.3M	572.7M	286.5M	286.2M	286.4M	286.3M	318.0M	254.6M	570.5M	0.0M
tih_rna_sample_00403_23H5VFLT4_s29	643.3M	0.0M	0.0M	46.4M	3.6M	576.2M	288.2M	287.9M	288.1M	288.1M	345.8M	230.4M	573.7M	0.0M
tih_rna_sample_00407_23H5VFLT4_s33	631.1M	0.0M	0.0M	60.0M	4.2M	545.5M	272.9M	272.6M	272.8M	272.7M	314.6M	230.9M	543.8M	0.0M
tih_rna_sample_00410_23H5VFLT4_s34	612.0M	0.0M	0.0M	57.6M	3.8M	530.3M	265.4M	265.0M	265.2M	265.1M	313.9M	216.5M	528.3M	0.0M
tih_rna_sample_00414_23H5VFLT4_s40	652.2M	0.0M	0.0M	56.0M	4.1M	569.4M	284.9M	284.5M	284.7M	284.7M	326.8M	242.7M	567.5M	0.0M
tih_rna_sample_00419_23H5VFLT4_s44	644.8M	0.0M	0.0M	49.1M	2.9M	573.6M	287.0M	286.6M	286.8M	286.8M	308.7M	264.9M	571.8M	0.0M
tih_rna_sample_00420_23H5VFLT4_s45	436.9M	0.0M	0.0M	45.4M	3.2M	372.1M	186.2M	185.9M	186.1M	186.1M	230.3M	141.8M	371.0M	0.0M
tih_rna_sample_00422_23H5VFLT4_s47	201.8M	0.0M	0.0M	31.6M	2.0M	158.7M	79.4M	79.2M	79.3M	79.3M	109.5M	49.2M	158.0M	0.0M
tih_rna_sample_00425_23H5VFLT4_s46	529.4M	0.0M	0.0M	62.7M	4.5M	442.2M	221.3M	220.9M	221.1M	221.1M	288.7M	153.4M	440.7M	0.0M
tih_rna_sample_00426_23H5VFLT4_s48	693.1M	0.0M	0.0M	116.2M	5.0M	536.2M	268.3M	267.9M	268.1M	268.1M	320.5M	215.7M	534.6M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	236895412	0.2118%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	4010	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	3520	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	1506	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	1387	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	188	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	171	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	174	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	147	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	142	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	180	0.0000%
GCTGCTGCCGGGGGGGC	2	79	0.0000%
GCCCCCCCGGCAGCAGC	2	83	0.0000%
GGCCCCCCCGGCAGCAGC	2	75	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAGGAGTATCTAGTAT	1	1701430	0.0015%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAGGAGTATCTAGTGT	1	286480	0.0003%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCTTCCAATCTGGGGG	1	820087	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGTACAGATCTGGGGG	1	1915598	0.0017%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGTACAGATCTGGGGT	1	737061	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTGATTGATCTGGTGT	1	926383	0.0008%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	64349805	0.1248%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	1990	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	1759	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	750	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	188	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	171	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	174	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	147	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	142	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	180	0.0000%
GCTGCTGCCGGGGGGGC	2	79	0.0000%
GCCCCCCCGGCAGCAGC	2	83	0.0000%
GGCCCCCCCGGCAGCAGC	2	75	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	1	691	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	253	0.0000%
GGGGGAGAGAGAGAGAGAGAGGGCGCGAAG	1	225	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	1	165	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	152	0.0000%
ACGGGAAGGCCCGGTGGGGAA	1	125	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCGTCACAGAGTAGCATCTAGTGTG	1	91	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp0003/B23H5VFLT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0001_exp0003_73d51683 --rundir 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/' --bclconvert_samplesheet 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/bclconvert_samplesheet.csv' --flowcell_id 20251217_LH00166_0224_B23H5VFLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp0003/B23H5VFLT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0001_exp0003_73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp0003/B23H5VFLT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/
flowcell_id: 20251217_LH00166_0224_B23H5VFLT4
strand: reverse
bclconvert_samplesheet: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks