MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-19, 23:31 UTC based on data in: /tmp/nxf.vRYOU0hmXx

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GM24385_0001_RNA_0001_23H5VFLT4_s08	No	0.00%	570406030	0.01%	0.64%	207441230	0.69%	0.72%	0.28%	0.28%	143730205	72755921	58098792	27728736	261.93	71.00	0.57%	0.47%	0.98	0.000	137.0bp	127.0bp	0.11%	1.25%	0.59%	0.00%	0.21%	3.52%	0.81%	0.00%	9999000000	209225167				140bp	216bp	64.3%	0.0%	87.3%	81.8%	93.8%	267.4M	38.3%	97.5%	70437.7Mb	570.4M	55.3%	97.8%	60.7%
GM24385_0001_RNA_0001_23H5VFLT4_s08_1																																	137.0bp	86.5%	246.6M																78.3%	54%	151bp	151bp	27%	291.5M
GM24385_0001_RNA_0001_23H5VFLT4_s08_2																																																			77.6%	55%	151bp	151bp	18%	291.5M
GM24385_0001_RNA_0001_23H5VFLT4_s08_trimmed_1																																																			78.3%	55%	127bp	137bp	18%	285.2M	78.3%	55%	127bp	137bp	18%	285.2M
GM24385_0001_RNA_0001_23H5VFLT4_s08_trimmed_2																																																			78.6%	55%	127bp	137bp	9%	285.2M	78.6%	55%	127bp	137bp	9%	285.2M
GM24385_0001_RNA_0001_23H5VFLT4_s16	No	0.00%	576413436	0.01%	0.64%	207381656	0.69%	0.73%	0.28%	0.27%	143829400	72821699	57923736	27599872	265.75	73.00	0.57%	0.47%	0.98	0.000	139.7bp	130.0bp	0.12%	1.23%	0.58%	0.00%	0.22%	3.49%	0.80%	0.00%	9999000000	207180981				144bp	227bp	64.7%	0.0%	87.5%	82.9%	94.0%	271.0M	39.9%	97.5%	71990.4Mb	576.4M	55.1%	97.7%	58.8%
GM24385_0001_RNA_0001_23H5VFLT4_s16_1																																	139.7bp	86.7%	250.0M																78.7%	54%	151bp	151bp	27%	294.9M
GM24385_0001_RNA_0001_23H5VFLT4_s16_2																																																			77.7%	55%	151bp	151bp	18%	294.9M
GM24385_0001_RNA_0001_23H5VFLT4_s16_trimmed_1																																																			78.7%	54%	128bp	137bp	18%	288.2M	78.7%	54%	128bp	137bp	18%	288.2M
GM24385_0001_RNA_0001_23H5VFLT4_s16_trimmed_2																																																			78.8%	55%	128bp	137bp	9%	288.2M	78.8%	55%	128bp	137bp	9%	288.2M
GM24385_0001_RNA_0001_23H5VFLT4_s24	No	0.00%	461024502	0.01%	0.61%	180664072	0.70%	0.73%	0.27%	0.27%	126957167	64182411	49147265	23494175	227.70	62.00	0.56%	0.45%	0.98	0.000	135.7bp	126.0bp	0.13%	1.24%	0.60%	0.00%	0.24%	3.49%	0.81%	0.00%	9999000000	195815702				138bp	210bp	61.4%	0.0%	87.4%	83.3%	94.1%	217.0M	36.8%	97.5%	56712.7Mb	461.0M	55.0%	97.6%	62.2%
GM24385_0001_RNA_0001_23H5VFLT4_s24_1																																	135.7bp	86.7%	199.9M																77.0%	54%	151bp	151bp	27%	236.1M
GM24385_0001_RNA_0001_23H5VFLT4_s24_2																																																			75.8%	55%	151bp	151bp	27%	236.1M
GM24385_0001_RNA_0001_23H5VFLT4_s24_trimmed_1																																																			77.0%	54%	126bp	132bp	18%	230.5M	77.0%	54%	126bp	132bp	18%	230.5M
GM24385_0001_RNA_0001_23H5VFLT4_s24_trimmed_2																																																			76.8%	55%	126bp	132bp	9%	230.5M	76.8%	55%	126bp	132bp	9%	230.5M
GM24385_0001_RNA_0001_23H5VFLT4_s32	No	0.00%	459063162	0.01%	0.72%	129294629	0.59%	0.62%	0.37%	0.38%	76253188	38585497	48420198	23436569	132.71	34.00	0.51%	0.36%	0.98	0.000	134.2bp	126.0bp	0.11%	1.22%	0.59%	0.00%	0.20%	3.42%	0.79%	0.00%	9999000000	137310685				135bp	201bp	72.6%	0.0%	86.6%	81.9%	93.8%	215.4M	43.9%	97.5%	56043.7Mb	459.1M	55.2%	97.3%	63.2%
GM24385_0001_RNA_0001_23H5VFLT4_s32_1																																	134.2bp	85.8%	196.9M																80.3%	54%	151bp	151bp	27%	236.0M
GM24385_0001_RNA_0001_23H5VFLT4_s32_2																																																			78.9%	55%	151bp	151bp	27%	236.0M
GM24385_0001_RNA_0001_23H5VFLT4_s32_trimmed_1																																																			80.2%	55%	125bp	132bp	18%	229.5M	80.2%	55%	125bp	132bp	18%	229.5M
GM24385_0001_RNA_0001_23H5VFLT4_s32_trimmed_2																																																			79.7%	55%	125bp	132bp	9%	229.5M	79.7%	55%	125bp	132bp	9%	229.5M
GM24385_0001_RNA_0001_23H5VFLT4_s40	No	0.00%	506350638	0.01%	0.76%	123848589	0.54%	0.58%	0.42%	0.42%	67465415	34098086	51639671	25137155	112.97	28.00	0.50%	0.32%	0.98	0.000	130.1bp	121.0bp	0.12%	1.27%	0.60%	0.00%	0.21%	3.55%	0.81%	0.00%	9999000000	130364108				130bp	191bp	76.3%	0.0%	87.1%	84.1%	94.5%	239.2M	44.2%	97.6%	60687.9Mb	506.4M	54.5%	97.4%	66.9%
GM24385_0001_RNA_0001_23H5VFLT4_s40_1																																	130.1bp	86.5%	218.9M																82.4%	53%	151bp	151bp	27%	260.1M
GM24385_0001_RNA_0001_23H5VFLT4_s40_2																																																			80.4%	54%	151bp	151bp	36%	260.1M
GM24385_0001_RNA_0001_23H5VFLT4_s40_trimmed_1																																																			82.3%	54%	123bp	127bp	18%	253.2M	82.3%	54%	123bp	127bp	18%	253.2M
GM24385_0001_RNA_0001_23H5VFLT4_s40_trimmed_2																																																			81.2%	54%	123bp	127bp	9%	253.2M	81.2%	54%	123bp	127bp	9%	253.2M
GM24385_0001_RNA_0001_23H5VFLT4_s48	No	0.00%	426034914	0.01%	0.74%	112297339	0.58%	0.61%	0.38%	0.39%	65284633	33031199	42812708	20707650	113.09	28.00	0.49%	0.32%	0.98	0.000	133.9bp	125.0bp	0.11%	1.24%	0.60%	0.00%	0.20%	3.48%	0.81%	0.00%	9999000000	122508015				134bp	203bp	74.4%	0.0%	87.4%	82.5%	94.0%	200.1M	45.6%	97.5%	51730.2Mb	426.0M	55.4%	97.3%	63.5%
GM24385_0001_RNA_0001_23H5VFLT4_s48_1																																	133.9bp	86.6%	184.4M																81.3%	54%	151bp	151bp	27%	219.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48_2																																																			79.4%	55%	151bp	151bp	36%	219.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48_trimmed_1																																																			81.2%	55%	124bp	132bp	18%	213.0M	81.2%	55%	124bp	132bp	18%	213.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48_trimmed_2																																																			80.5%	55%	125bp	132bp	9%	213.0M	80.5%	55%	125bp	132bp	9%	213.0M
HD789_0002_RNA_0008_23H5VFLT4_s19	Yes	63.08%	593548900	0.00%	0.46%	322025587	0.89%	0.92%	0.10%	0.08%	287992943	146486933	31505657	12679832	641.86	272.00	0.71%	0.62%	0.98	0.000	175.0bp	158.0bp	0.10%	1.14%	0.56%	0.00%	0.21%	3.34%	0.79%	0.00%	9999000000	413539117				253bp	690bp	45.9%	0.0%	94.6%	90.0%	96.3%	285.7M	34.8%	97.6%	80338.3Mb	593.5M	54.7%	98.9%	36.6%
HD789_0002_RNA_0008_23H5VFLT4_s19_1																																	175.0bp	94.7%	281.0M																83.5%	54%	151bp	151bp	27%	487.1M
HD789_0002_RNA_0008_23H5VFLT4_s19_2																																																			83.7%	55%	151bp	151bp	18%	487.1M
HD789_0002_RNA_0008_23H5VFLT4_s19_trimmed_1																																																			80.1%	54%	139bp	151bp	18%	296.8M	80.1%	54%	139bp	151bp	18%	296.8M
HD789_0002_RNA_0008_23H5VFLT4_s19_trimmed_2																																																			81.1%	55%	139bp	151bp	9%	296.8M	81.1%	55%	139bp	151bp	9%	296.8M
NTC_0001_0001_23H5VFLT4_s15	Skipped	N/A%	72882	0.35%	0.42%	42135	0.01%	0.02%	0.39%	0.98%	424	191	16275	7903	0.00	0.00	0.00%	0.00%	0.92	0.000	32.9bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	9999000000	36700				24bp	27bp	64.8%	2.5%	4.4%	1.8%	9.2%	0.0M	43.6%	89.6%	4.3Mb	0.1M	67.9%	17.6%	56.0%
NTC_0001_0001_23H5VFLT4_s15_1																																	32.9bp	3.3%	0.0M																89.4%	73%	151bp	151bp	55%	0.2M
NTC_0001_0001_23H5VFLT4_s15_2																																																			88.1%	93%	151bp	151bp	55%	0.2M
NTC_0001_0001_23H5VFLT4_s15_trimmed_1																																																			51.0%	65%	64bp	37bp	36%	0.0M	51.0%	65%	64bp	37bp	36%	0.0M
NTC_0001_0001_23H5VFLT4_s15_trimmed_2																																																			53.1%	70%	66bp	37bp	45%	0.0M	53.1%	70%	66bp	37bp	45%	0.0M
V4_0001_RNA_0001_23H5VFLT4_s13	No	0.00%	593523800	0.01%	0.51%	293407008	0.87%	0.90%	0.12%	0.10%	256061434	130017534	34262500	14643915	541.97	133.00	0.60%	0.52%	0.98	0.000	161.4bp	149.0bp	0.10%	1.16%	0.99%	0.00%	0.19%	3.21%	1.35%	0.00%	9999000000	341145011				210bp	517bp	50.8%	0.0%	93.7%	89.3%	95.9%	284.5M	36.3%	97.6%	78958.9Mb	593.5M	54.6%	98.9%	43.4%
V4_0001_RNA_0001_23H5VFLT4_s13_1																																	161.4bp	93.3%	276.9M																81.9%	54%	151bp	151bp	27%	381.8M
V4_0001_RNA_0001_23H5VFLT4_s13_2																																																			82.2%	54%	151bp	151bp	18%	381.8M
V4_0001_RNA_0001_23H5VFLT4_s13_trimmed_1																																																			80.1%	54%	136bp	151bp	18%	296.8M	80.1%	54%	136bp	151bp	18%	296.8M
V4_0001_RNA_0001_23H5VFLT4_s13_trimmed_2																																																			81.3%	54%	136bp	151bp	9%	296.8M	81.3%	54%	136bp	151bp	9%	296.8M
V4_0001_RNA_0005_23H5VFLT4_s01	No	0.00%	588390366	0.01%	0.55%	265378422	0.81%	0.84%	0.17%	0.16%	215422320	109276974	46098772	20922970	435.46	110.00	0.59%	0.51%	0.98	0.000	151.6bp	139.0bp	0.14%	1.09%	0.78%	0.00%	0.26%	3.02%	1.02%	0.00%	9999000000	284446973				173bp	358bp	55.3%	0.0%	90.9%	85.4%	94.8%	279.0M	35.9%	97.5%	76152.1Mb	588.4M	55.0%	98.1%	49.4%
V4_0001_RNA_0005_23H5VFLT4_s01_1																																	151.6bp	90.2%	265.2M																80.8%	54%	151bp	151bp	27%	388.2M
V4_0001_RNA_0005_23H5VFLT4_s01_2																																																			80.2%	55%	151bp	151bp	18%	388.2M
V4_0001_RNA_0005_23H5VFLT4_s01_trimmed_1																																																			78.6%	54%	133bp	151bp	18%	294.2M	78.6%	54%	133bp	151bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s01_trimmed_2																																																			79.1%	55%	133bp	151bp	18%	294.2M	79.1%	55%	133bp	151bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s02	No	0.00%	588493008	0.01%	0.58%	246490361	0.78%	0.81%	0.20%	0.19%	193420271	98011542	48943078	22650863	379.46	100.00	0.58%	0.50%	0.98	0.000	146.9bp	135.0bp	0.14%	1.13%	0.75%	0.00%	0.27%	3.15%	0.98%	0.00%	9999000000	257331784				161bp	312bp	58.5%	0.0%	90.3%	85.6%	94.9%	279.2M	37.8%	97.6%	75149.4Mb	588.5M	54.6%	98.1%	53.1%
V4_0001_RNA_0005_23H5VFLT4_s02_1																																	146.9bp	89.7%	264.0M																79.7%	53%	151bp	151bp	27%	343.4M
V4_0001_RNA_0005_23H5VFLT4_s02_2																																																			79.0%	54%	151bp	151bp	18%	343.4M
V4_0001_RNA_0005_23H5VFLT4_s02_trimmed_1																																																			78.6%	54%	131bp	147bp	18%	294.2M	78.6%	54%	131bp	147bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s02_trimmed_2																																																			79.0%	54%	131bp	147bp	18%	294.2M	79.0%	54%	131bp	147bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s03	No	0.00%	588325858	0.01%	0.61%	228818941	0.76%	0.79%	0.22%	0.21%	173965946	88212354	50413615	23492896	340.05	91.00	0.58%	0.49%	0.98	0.000	147.5bp	136.0bp	0.12%	1.16%	0.69%	0.00%	0.23%	3.27%	0.92%	0.00%	9999000000	232301237				159bp	298bp	61.6%	0.0%	89.7%	84.5%	94.6%	278.2M	40.6%	97.6%	75228.5Mb	588.3M	54.9%	98.1%	53.1%
V4_0001_RNA_0005_23H5VFLT4_s03_1																																	147.5bp	89.0%	261.9M																80.8%	54%	151bp	151bp	27%	369.1M
V4_0001_RNA_0005_23H5VFLT4_s03_2																																																			79.8%	55%	151bp	151bp	18%	369.1M
V4_0001_RNA_0005_23H5VFLT4_s03_trimmed_1																																																			79.0%	54%	131bp	147bp	18%	294.2M	79.0%	54%	131bp	147bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s03_trimmed_2																																																			79.2%	55%	131bp	147bp	18%	294.2M	79.2%	55%	131bp	147bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s04	No	0.00%	587220258	0.01%	0.64%	214221991	0.73%	0.76%	0.25%	0.24%	155919772	79024877	53366448	25151128	298.24	80.00	0.57%	0.48%	0.98	0.000	144.4bp	133.0bp	0.12%	1.19%	0.65%	0.00%	0.22%	3.35%	0.87%	0.00%	9999000000	215320813				153bp	268bp	64.1%	0.0%	88.8%	84.0%	94.4%	277.2M	40.9%	97.5%	74424.8Mb	587.2M	54.9%	97.9%	55.0%
V4_0001_RNA_0005_23H5VFLT4_s04_1																																	144.4bp	88.1%	258.7M																79.3%	54%	151bp	151bp	27%	311.3M
V4_0001_RNA_0005_23H5VFLT4_s04_2																																																			78.5%	55%	151bp	151bp	18%	311.3M
V4_0001_RNA_0005_23H5VFLT4_s04_trimmed_1																																																			79.0%	54%	130bp	142bp	18%	293.6M	79.0%	54%	130bp	142bp	18%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s04_trimmed_2																																																			79.2%	55%	130bp	142bp	9%	293.6M	79.2%	55%	130bp	142bp	9%	293.6M
V4_0001_RNA_0005_23H5VFLT4_s05	No	0.00%	586367422	0.01%	0.64%	209114697	0.71%	0.74%	0.26%	0.26%	148762595	75331159	54912233	26074911	275.12	74.00	0.57%	0.47%	0.98	0.000	139.5bp	130.0bp	0.11%	1.22%	0.63%	0.00%	0.20%	3.42%	0.85%	0.00%	9999000000	208165529				143bp	232bp	64.9%	0.0%	88.4%	82.1%	93.9%	275.4M	40.6%	97.5%	72940.1Mb	586.4M	55.5%	97.7%	59.3%
V4_0001_RNA_0005_23H5VFLT4_s05_1																																	139.5bp	87.5%	256.7M																79.0%	54%	151bp	151bp	27%	302.0M
V4_0001_RNA_0005_23H5VFLT4_s05_2																																																			78.0%	55%	151bp	151bp	18%	302.0M
V4_0001_RNA_0005_23H5VFLT4_s05_trimmed_1																																																			79.0%	55%	128bp	137bp	18%	293.2M	79.0%	55%	128bp	137bp	18%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s05_trimmed_2																																																			79.0%	55%	128bp	137bp	9%	293.2M	79.0%	55%	128bp	137bp	9%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s06	No	0.00%	586512046	0.01%	0.65%	206637255	0.70%	0.73%	0.27%	0.27%	145412294	73631467	55877048	26574701	268.53	73.00	0.57%	0.47%	0.98	0.000	140.1bp	130.0bp	0.11%	1.23%	0.61%	0.00%	0.20%	3.46%	0.82%	0.00%	9999000000	204070100				144bp	232bp	65.4%	0.0%	88.2%	82.9%	94.1%	276.0M	40.9%	97.5%	73201.6Mb	586.5M	55.2%	97.8%	59.0%
V4_0001_RNA_0005_23H5VFLT4_s06_1																																	140.1bp	87.4%	256.4M																79.3%	54%	151bp	151bp	27%	312.8M
V4_0001_RNA_0005_23H5VFLT4_s06_2																																																			78.2%	55%	151bp	151bp	18%	312.8M
V4_0001_RNA_0005_23H5VFLT4_s06_trimmed_1																																																			79.0%	55%	128bp	137bp	18%	293.3M	79.0%	55%	128bp	137bp	18%	293.3M
V4_0001_RNA_0005_23H5VFLT4_s06_trimmed_2																																																			79.0%	55%	128bp	137bp	9%	293.3M	79.0%	55%	128bp	137bp	9%	293.3M
V4_0001_RNA_0005_23H5VFLT4_s07	No	0.00%	507719532	0.01%	0.66%	172336511	0.66%	0.69%	0.31%	0.31%	113136719	57291297	53638444	25704926	205.02	54.00	0.55%	0.43%	0.98	0.000	137.8bp	128.0bp	0.12%	1.20%	0.59%	0.00%	0.22%	3.36%	0.80%	0.00%	9999000000	180516629				139bp	208bp	66.8%	0.0%	86.4%	79.6%	93.1%	236.3M	40.3%	97.4%	62803.5Mb	507.7M	56.0%	97.5%	60.5%
V4_0001_RNA_0005_23H5VFLT4_s07_1																																	137.8bp	85.3%	216.5M																78.2%	55%	151bp	151bp	27%	260.4M
V4_0001_RNA_0005_23H5VFLT4_s07_2																																																			76.9%	56%	151bp	151bp	27%	260.4M
V4_0001_RNA_0005_23H5VFLT4_s07_trimmed_1																																																			78.1%	55%	127bp	137bp	18%	253.9M	78.1%	55%	127bp	137bp	18%	253.9M
V4_0001_RNA_0005_23H5VFLT4_s07_trimmed_2																																																			78.0%	56%	127bp	137bp	9%	253.9M	78.0%	56%	127bp	137bp	9%	253.9M
V4_0001_RNA_0005_23H5VFLT4_s09	No	0.00%	589935114	0.01%	0.53%	278023084	0.82%	0.85%	0.17%	0.15%	228221333	115831527	46340262	20920331	471.17	124.00	0.59%	0.52%	0.98	0.000	155.1bp	142.0bp	0.15%	1.09%	0.78%	0.00%	0.28%	3.06%	1.02%	0.00%	9999000000	305749649				184bp	407bp	53.2%	0.0%	91.2%	87.6%	95.5%	281.6M	35.6%	97.6%	77188.5Mb	589.9M	54.0%	98.3%	47.1%
V4_0001_RNA_0005_23H5VFLT4_s09_1																																	155.1bp	90.7%	267.6M																80.3%	53%	151bp	151bp	27%	358.3M
V4_0001_RNA_0005_23H5VFLT4_s09_2																																																			79.7%	54%	151bp	151bp	18%	358.3M
V4_0001_RNA_0005_23H5VFLT4_s09_trimmed_1																																																			78.9%	53%	134bp	151bp	18%	295.0M	78.9%	53%	134bp	151bp	18%	295.0M
V4_0001_RNA_0005_23H5VFLT4_s09_trimmed_2																																																			79.3%	54%	134bp	151bp	18%	295.0M	79.3%	54%	134bp	151bp	18%	295.0M
V4_0001_RNA_0005_23H5VFLT4_s10	No	0.00%	589132864	0.01%	0.57%	255114561	0.80%	0.83%	0.19%	0.17%	203581063	103267518	47686449	21852173	412.13	110.00	0.59%	0.51%	0.98	0.000	152.5bp	140.0bp	0.14%	1.11%	0.74%	0.00%	0.26%	3.14%	0.96%	0.00%	9999000000	265331390				174bp	364bp	57.1%	0.0%	90.6%	86.9%	95.2%	280.5M	39.1%	97.6%	76711.2Mb	589.1M	54.3%	98.2%	48.9%
V4_0001_RNA_0005_23H5VFLT4_s10_1																																	152.5bp	90.1%	265.5M																80.4%	53%	151bp	151bp	27%	356.2M
V4_0001_RNA_0005_23H5VFLT4_s10_2																																																			79.8%	54%	151bp	151bp	18%	356.2M
V4_0001_RNA_0005_23H5VFLT4_s10_trimmed_1																																																			79.0%	54%	133bp	151bp	18%	294.6M	79.0%	54%	133bp	151bp	18%	294.6M
V4_0001_RNA_0005_23H5VFLT4_s10_trimmed_2																																																			79.6%	54%	133bp	151bp	18%	294.6M	79.6%	54%	133bp	151bp	18%	294.6M
V4_0001_RNA_0005_23H5VFLT4_s11	No	0.00%	563578038	0.01%	0.58%	234300774	0.77%	0.80%	0.21%	0.20%	180130022	91415193	50048469	23211004	361.60	99.00	0.58%	0.50%	0.98	0.000	152.0bp	141.0bp	0.13%	1.13%	0.68%	0.00%	0.24%	3.22%	0.90%	0.00%	9999000000	244468500				170bp	334bp	58.9%	0.0%	89.4%	85.9%	95.0%	267.6M	38.8%	97.6%	73390.1Mb	563.6M	54.3%	98.2%	49.1%
V4_0001_RNA_0005_23H5VFLT4_s11_1																																	152.0bp	88.9%	250.5M																78.0%	53%	151bp	151bp	27%	286.8M
V4_0001_RNA_0005_23H5VFLT4_s11_2																																																			77.8%	54%	151bp	151bp	18%	286.8M
V4_0001_RNA_0005_23H5VFLT4_s11_trimmed_1																																																			78.1%	54%	133bp	151bp	18%	281.8M	78.1%	54%	133bp	151bp	18%	281.8M
V4_0001_RNA_0005_23H5VFLT4_s11_trimmed_2																																																			78.7%	54%	133bp	151bp	9%	281.8M	78.7%	54%	133bp	151bp	9%	281.8M
V4_0001_RNA_0005_23H5VFLT4_s12	No	0.00%	587578574	0.01%	0.62%	224747163	0.73%	0.76%	0.24%	0.24%	164867360	83567127	54965100	25900155	315.36	86.00	0.58%	0.49%	0.98	0.000	144.8bp	133.0bp	0.12%	1.19%	0.65%	0.00%	0.23%	3.36%	0.87%	0.00%	9999000000	229019198				153bp	266bp	62.3%	0.0%	88.6%	84.2%	94.5%	277.5M	40.1%	97.5%	74540.0Mb	587.6M	54.8%	97.9%	55.0%
V4_0001_RNA_0005_23H5VFLT4_s12_1																																	144.8bp	87.9%	258.3M																80.9%	54%	151bp	151bp	27%	384.6M
V4_0001_RNA_0005_23H5VFLT4_s12_2																																																			79.8%	55%	151bp	151bp	18%	384.6M
V4_0001_RNA_0005_23H5VFLT4_s12_trimmed_1																																																			78.7%	54%	130bp	142bp	18%	293.8M	78.7%	54%	130bp	142bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s12_trimmed_2																																																			78.9%	55%	130bp	142bp	18%	293.8M	78.9%	55%	130bp	142bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s13	No	0.00%	588334522	0.01%	0.67%	196295987	0.70%	0.73%	0.28%	0.27%	136882376	69415781	54335816	25759744	261.42	70.00	0.56%	0.47%	0.98	0.000	146.9bp	136.0bp	0.11%	1.17%	0.61%	0.00%	0.21%	3.35%	0.82%	0.00%	9999000000	196601339				156bp	269bp	67.2%	0.0%	88.4%	84.6%	94.5%	278.1M	44.9%	97.5%	75400.7Mb	588.3M	54.9%	98.1%	53.6%
V4_0001_RNA_0005_23H5VFLT4_s13_1																																	146.9bp	87.8%	258.3M																81.1%	54%	151bp	151bp	27%	337.9M
V4_0001_RNA_0005_23H5VFLT4_s13_2																																																			80.0%	55%	151bp	151bp	18%	337.9M
V4_0001_RNA_0005_23H5VFLT4_s13_trimmed_1																																																			80.2%	54%	131bp	147bp	18%	294.2M	80.2%	54%	131bp	147bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s13_trimmed_2																																																			80.2%	55%	131bp	147bp	18%	294.2M	80.2%	55%	131bp	147bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s14	No	0.00%	588107382	0.01%	0.65%	205840776	0.70%	0.73%	0.27%	0.27%	144749699	73329672	55817542	26515961	271.37	74.00	0.57%	0.47%	0.98	0.000	142.5bp	133.0bp	0.11%	1.20%	0.60%	0.00%	0.20%	3.42%	0.81%	0.00%	9999000000	206919364				150bp	248bp	65.6%	0.0%	88.3%	84.0%	94.4%	277.6M	41.6%	97.5%	74534.5Mb	588.1M	54.9%	98.0%	56.4%
V4_0001_RNA_0005_23H5VFLT4_s14_1																																	142.5bp	87.7%	257.8M																79.5%	54%	151bp	151bp	27%	311.1M
V4_0001_RNA_0005_23H5VFLT4_s14_2																																																			78.5%	55%	151bp	151bp	18%	311.1M
V4_0001_RNA_0005_23H5VFLT4_s14_trimmed_1																																																			79.2%	54%	130bp	142bp	18%	294.1M	79.2%	54%	130bp	142bp	18%	294.1M
V4_0001_RNA_0005_23H5VFLT4_s14_trimmed_2																																																			79.2%	55%	130bp	142bp	9%	294.1M	79.2%	55%	130bp	142bp	9%	294.1M
V4_0001_RNA_0005_23H5VFLT4_s15	No	0.00%	554380956	0.01%	0.62%	207967984	0.71%	0.74%	0.27%	0.26%	147830378	74918055	55125659	26146602	280.45	78.00	0.57%	0.48%	0.98	0.000	144.6bp	134.0bp	0.11%	1.21%	0.58%	0.00%	0.21%	3.44%	0.80%	0.00%	9999000000	208640613				151bp	249bp	63.1%	0.0%	87.7%	84.0%	94.4%	261.6M	39.5%	97.5%	70548.6Mb	554.4M	54.9%	97.9%	55.4%
V4_0001_RNA_0005_23H5VFLT4_s15_1																																	144.6bp	87.0%	241.2M																77.9%	54%	151bp	151bp	27%	283.2M
V4_0001_RNA_0005_23H5VFLT4_s15_2																																																			77.3%	55%	151bp	151bp	18%	283.2M
V4_0001_RNA_0005_23H5VFLT4_s15_trimmed_1																																																			77.9%	54%	130bp	142bp	18%	277.2M	77.9%	54%	130bp	142bp	18%	277.2M
V4_0001_RNA_0005_23H5VFLT4_s15_trimmed_2																																																			78.3%	55%	131bp	142bp	9%	277.2M	78.3%	55%	131bp	142bp	9%	277.2M
V4_0001_RNA_0005_23H5VFLT4_s17	No	0.00%	589515330	0.01%	0.53%	278941449	0.82%	0.85%	0.16%	0.15%	229897686	116637714	45651479	20589809	473.15	125.00	0.59%	0.52%	0.98	0.000	155.6bp	143.0bp	0.16%	1.08%	0.77%	0.00%	0.30%	3.05%	1.00%	0.00%	9999000000	306684966				187bp	421bp	53.0%	0.0%	91.3%	88.0%	95.6%	281.8M	36.0%	97.6%	77103.6Mb	589.5M	53.7%	98.3%	46.6%
V4_0001_RNA_0005_23H5VFLT4_s17_1																																	155.6bp	90.9%	267.9M																82.0%	53%	151bp	151bp	27%	444.0M
V4_0001_RNA_0005_23H5VFLT4_s17_2																																																			81.4%	54%	151bp	151bp	18%	444.0M
V4_0001_RNA_0005_23H5VFLT4_s17_trimmed_1																																																			78.9%	53%	134bp	151bp	27%	294.8M	78.9%	53%	134bp	151bp	27%	294.8M
V4_0001_RNA_0005_23H5VFLT4_s17_trimmed_2																																																			79.4%	54%	134bp	151bp	18%	294.8M	79.4%	54%	134bp	151bp	18%	294.8M
V4_0001_RNA_0005_23H5VFLT4_s18	No	0.00%	587608938	0.01%	0.56%	259085711	0.80%	0.83%	0.19%	0.17%	206759702	104851430	48381183	22155005	416.46	112.00	0.59%	0.51%	0.98	0.000	151.7bp	139.0bp	0.14%	1.12%	0.74%	0.00%	0.27%	3.16%	0.96%	0.00%	9999000000	276346590				172bp	356bp	56.3%	0.0%	90.5%	86.4%	95.1%	279.5M	37.3%	97.6%	76113.3Mb	587.6M	54.2%	97.9%	49.6%
V4_0001_RNA_0005_23H5VFLT4_s18_1																																	151.7bp	90.0%	264.3M																80.1%	53%	151bp	151bp	27%	350.2M
V4_0001_RNA_0005_23H5VFLT4_s18_2																																																			79.4%	54%	151bp	151bp	18%	350.2M
V4_0001_RNA_0005_23H5VFLT4_s18_trimmed_1																																																			78.8%	53%	133bp	151bp	18%	293.8M	78.8%	53%	133bp	151bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s18_trimmed_2																																																			79.3%	54%	133bp	151bp	18%	293.8M	79.3%	54%	133bp	151bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s19	No	0.00%	589319004	0.01%	0.60%	235382871	0.76%	0.79%	0.22%	0.21%	178284241	90482967	52644157	24489494	356.34	98.00	0.58%	0.50%	0.98	0.000	151.3bp	139.0bp	0.13%	1.14%	0.68%	0.00%	0.25%	3.25%	0.90%	0.00%	9999000000	238569006				167bp	326bp	60.5%	0.0%	89.2%	85.6%	94.9%	279.6M	40.3%	97.6%	76241.2Mb	589.3M	54.2%	98.2%	49.9%
V4_0001_RNA_0005_23H5VFLT4_s19_1																																	151.3bp	88.6%	261.1M																80.7%	53%	151bp	151bp	27%	353.8M
V4_0001_RNA_0005_23H5VFLT4_s19_2																																																			79.8%	54%	151bp	151bp	18%	353.8M
V4_0001_RNA_0005_23H5VFLT4_s19_trimmed_1																																																			79.2%	53%	133bp	151bp	18%	294.7M	79.2%	53%	133bp	151bp	18%	294.7M
V4_0001_RNA_0005_23H5VFLT4_s19_trimmed_2																																																			79.5%	54%	133bp	151bp	18%	294.7M	79.5%	54%	133bp	151bp	18%	294.7M
V4_0001_RNA_0005_23H5VFLT4_s20	No	0.00%	587562974	0.01%	0.61%	230301992	0.74%	0.77%	0.24%	0.23%	170473327	86420346	54851878	25766902	329.50	91.00	0.58%	0.49%	0.98	0.000	146.2bp	135.0bp	0.13%	1.18%	0.65%	0.00%	0.24%	3.35%	0.86%	0.00%	9999000000	233494542				155bp	276bp	61.3%	0.0%	88.6%	83.8%	94.4%	277.3M	39.2%	97.5%	74827.5Mb	587.6M	54.6%	97.9%	53.9%
V4_0001_RNA_0005_23H5VFLT4_s20_1																																	146.2bp	87.9%	258.2M																79.4%	54%	151bp	151bp	27%	320.4M
V4_0001_RNA_0005_23H5VFLT4_s20_2																																																			78.4%	54%	151bp	151bp	18%	320.4M
V4_0001_RNA_0005_23H5VFLT4_s20_trimmed_1																																																			78.9%	54%	131bp	142bp	18%	293.8M	78.9%	54%	131bp	142bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s20_trimmed_2																																																			78.8%	54%	131bp	147bp	18%	293.8M	78.8%	54%	131bp	147bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s21	No	0.00%	583490244	0.01%	0.63%	216307678	0.72%	0.75%	0.26%	0.25%	155216871	78632167	55876749	26444682	292.79	80.00	0.57%	0.48%	0.98	0.000	142.2bp	132.0bp	0.12%	1.21%	0.62%	0.00%	0.22%	3.42%	0.83%	0.00%	9999000000	219633877				149bp	250bp	63.5%	0.0%	88.4%	83.0%	94.2%	274.8M	39.5%	97.5%	73538.9Mb	583.5M	54.8%	97.9%	56.7%
V4_0001_RNA_0005_23H5VFLT4_s21_1																																	142.2bp	87.6%	255.7M																78.8%	54%	151bp	151bp	27%	298.1M
V4_0001_RNA_0005_23H5VFLT4_s21_2																																																			77.8%	55%	151bp	151bp	18%	298.1M
V4_0001_RNA_0005_23H5VFLT4_s21_trimmed_1																																																			78.8%	54%	129bp	142bp	18%	291.7M	78.8%	54%	129bp	142bp	18%	291.7M
V4_0001_RNA_0005_23H5VFLT4_s21_trimmed_2																																																			78.8%	55%	129bp	142bp	9%	291.7M	78.8%	55%	129bp	142bp	9%	291.7M
V4_0001_RNA_0005_23H5VFLT4_s22	No	0.00%	510436288	0.01%	0.61%	200162836	0.72%	0.75%	0.25%	0.25%	144571781	73229481	50932341	24102397	273.51	76.00	0.57%	0.47%	0.98	0.000	143.5bp	133.0bp	0.12%	1.21%	0.60%	0.00%	0.23%	3.43%	0.82%	0.00%	9999000000	204485400				149bp	248bp	61.3%	0.0%	87.9%	83.8%	94.3%	240.7M	38.1%	97.5%	64486.7Mb	510.4M	54.7%	97.9%	56.2%
V4_0001_RNA_0005_23H5VFLT4_s22_1																																	143.5bp	87.2%	222.7M																77.4%	54%	151bp	151bp	27%	260.6M
V4_0001_RNA_0005_23H5VFLT4_s22_2																																																			76.5%	54%	151bp	151bp	18%	260.6M
V4_0001_RNA_0005_23H5VFLT4_s22_trimmed_1																																																			77.5%	54%	129bp	142bp	18%	255.2M	77.5%	54%	129bp	142bp	18%	255.2M
V4_0001_RNA_0005_23H5VFLT4_s22_trimmed_2																																																			77.6%	54%	130bp	142bp	9%	255.2M	77.6%	54%	130bp	142bp	9%	255.2M
V4_0001_RNA_0005_23H5VFLT4_s23	No	0.00%	572221808	0.01%	0.68%	184586834	0.67%	0.70%	0.30%	0.30%	123892948	62779086	55285023	26385636	231.87	62.00	0.56%	0.45%	0.98	0.000	141.7bp	132.0bp	0.12%	1.23%	0.59%	0.00%	0.22%	3.49%	0.80%	0.00%	9999000000	176618396				147bp	239bp	68.4%	0.0%	87.6%	83.1%	94.1%	269.3M	43.2%	97.5%	72012.7Mb	572.2M	54.9%	97.9%	57.0%
V4_0001_RNA_0005_23H5VFLT4_s23_1																																	141.7bp	86.9%	248.5M																79.6%	54%	151bp	151bp	27%	292.3M
V4_0001_RNA_0005_23H5VFLT4_s23_2																																																			78.5%	55%	151bp	151bp	18%	292.3M
V4_0001_RNA_0005_23H5VFLT4_s23_trimmed_1																																																			79.6%	54%	129bp	142bp	18%	286.1M	79.6%	54%	129bp	142bp	18%	286.1M
V4_0001_RNA_0005_23H5VFLT4_s23_trimmed_2																																																			79.6%	55%	129bp	142bp	9%	286.1M	79.6%	55%	129bp	142bp	9%	286.1M
V4_0001_RNA_0005_23H5VFLT4_s25	No	0.00%	588442154	0.01%	0.62%	224250257	0.79%	0.82%	0.19%	0.18%	177477088	90068525	43258650	19807092	354.92	86.00	0.57%	0.49%	0.98	0.000	151.7bp	139.0bp	0.13%	1.07%	0.79%	0.00%	0.24%	2.99%	1.02%	0.00%	9999000000	225738286				177bp	381bp	62.3%	0.0%	91.5%	87.3%	95.4%	280.8M	41.2%	97.5%	76171.1Mb	588.4M	54.5%	98.1%	49.5%
V4_0001_RNA_0005_23H5VFLT4_s25_1																																	151.7bp	91.0%	267.8M																83.6%	53%	151bp	151bp	27%	433.1M
V4_0001_RNA_0005_23H5VFLT4_s25_2																																																			82.5%	54%	151bp	151bp	18%	433.1M
V4_0001_RNA_0005_23H5VFLT4_s25_trimmed_1																																																			80.7%	54%	133bp	151bp	27%	294.2M	80.7%	54%	133bp	151bp	27%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s25_trimmed_2																																																			80.8%	54%	133bp	151bp	18%	294.2M	80.8%	54%	133bp	151bp	18%	294.2M
V4_0001_RNA_0005_23H5VFLT4_s26	No	0.00%	585166962	0.01%	0.64%	209799483	0.76%	0.79%	0.22%	0.21%	159191572	80790000	46632766	21560746	319.09	81.00	0.57%	0.48%	0.98	0.000	153.5bp	141.0bp	0.13%	1.09%	0.72%	0.00%	0.23%	3.10%	0.95%	0.00%	9999000000	208552155				175bp	367bp	64.6%	0.0%	90.4%	86.5%	95.1%	278.3M	42.9%	97.5%	75895.6Mb	585.2M	54.1%	97.5%	48.6%
V4_0001_RNA_0005_23H5VFLT4_s26_1																																	153.5bp	89.8%	262.9M																83.0%	53%	151bp	151bp	27%	409.4M
V4_0001_RNA_0005_23H5VFLT4_s26_2																																																			82.0%	54%	151bp	151bp	18%	409.4M
V4_0001_RNA_0005_23H5VFLT4_s26_trimmed_1																																																			80.4%	53%	133bp	151bp	27%	292.6M	80.4%	53%	133bp	151bp	27%	292.6M
V4_0001_RNA_0005_23H5VFLT4_s26_trimmed_2																																																			80.7%	54%	133bp	151bp	18%	292.6M	80.7%	54%	133bp	151bp	18%	292.6M
V4_0001_RNA_0005_23H5VFLT4_s27	No	0.00%	587062688	0.01%	0.71%	171128330	0.69%	0.72%	0.29%	0.28%	117439835	59627492	49364418	23286241	229.62	58.00	0.55%	0.45%	0.98	0.000	151.2bp	139.0bp	0.12%	1.12%	0.68%	0.00%	0.22%	3.21%	0.90%	0.00%	9999000000	168150730				167bp	328bp	71.4%	0.0%	89.2%	85.8%	94.9%	278.7M	48.8%	97.6%	75911.1Mb	587.1M	54.1%	97.8%	50.2%
V4_0001_RNA_0005_23H5VFLT4_s27_1																																	151.2bp	88.7%	260.4M																83.1%	53%	151bp	151bp	27%	350.5M
V4_0001_RNA_0005_23H5VFLT4_s27_2																																																			81.6%	54%	151bp	151bp	18%	350.5M
V4_0001_RNA_0005_23H5VFLT4_s27_trimmed_1																																																			81.9%	53%	132bp	151bp	18%	293.5M	81.9%	53%	132bp	151bp	18%	293.5M
V4_0001_RNA_0005_23H5VFLT4_s27_trimmed_2																																																			81.6%	54%	133bp	151bp	18%	293.5M	81.6%	54%	133bp	151bp	18%	293.5M
V4_0001_RNA_0005_23H5VFLT4_s28	No	0.00%	469911882	0.01%	0.68%	149957019	0.69%	0.72%	0.29%	0.28%	102995136	52233573	43070207	20439159	195.78	50.00	0.54%	0.43%	0.98	0.000	145.8bp	134.0bp	0.12%	1.15%	0.64%	0.00%	0.22%	3.27%	0.87%	0.00%	9999000000	149945740				155bp	278bp	68.7%	0.0%	88.5%	84.1%	94.5%	222.1M	44.4%	97.5%	59744.7Mb	469.9M	54.5%	97.6%	53.9%
V4_0001_RNA_0005_23H5VFLT4_s28_1																																	145.8bp	87.9%	206.4M																79.7%	54%	151bp	151bp	27%	240.7M
V4_0001_RNA_0005_23H5VFLT4_s28_2																																																			78.4%	54%	151bp	151bp	27%	240.7M
V4_0001_RNA_0005_23H5VFLT4_s28_trimmed_1																																																			79.7%	54%	130bp	142bp	18%	235.0M	79.7%	54%	130bp	142bp	18%	235.0M
V4_0001_RNA_0005_23H5VFLT4_s28_trimmed_2																																																			79.4%	54%	130bp	142bp	9%	235.0M	79.4%	54%	130bp	142bp	9%	235.0M
V4_0001_RNA_0005_23H5VFLT4_s29	No	0.00%	585267498	0.01%	0.73%	158154481	0.62%	0.65%	0.35%	0.35%	98068426	49700149	55184275	26528006	180.00	46.00	0.54%	0.41%	0.98	0.000	142.0bp	131.0bp	0.11%	1.19%	0.62%	0.00%	0.20%	3.37%	0.83%	0.00%	9999000000	157819156				147bp	246bp	73.6%	0.0%	87.9%	85.2%	94.7%	277.2M	48.3%	97.6%	73671.3Mb	585.3M	54.4%	97.5%	57.4%
V4_0001_RNA_0005_23H5VFLT4_s29_1																																	142.0bp	87.4%	255.8M																82.5%	54%	151bp	151bp	27%	320.0M
V4_0001_RNA_0005_23H5VFLT4_s29_2																																																			81.0%	54%	151bp	151bp	27%	320.0M
V4_0001_RNA_0005_23H5VFLT4_s29_trimmed_1																																																			82.0%	54%	129bp	142bp	18%	292.6M	82.0%	54%	129bp	142bp	18%	292.6M
V4_0001_RNA_0005_23H5VFLT4_s29_trimmed_2																																																			81.5%	54%	129bp	142bp	18%	292.6M	81.5%	54%	129bp	142bp	18%	292.6M
V4_0001_RNA_0005_23H5VFLT4_s30	No	0.00%	481215060	0.01%	0.69%	148616118	0.65%	0.68%	0.32%	0.32%	96918597	49120254	47359305	22677467	179.42	47.00	0.54%	0.41%	0.98	0.000	141.6bp	131.0bp	0.11%	1.22%	0.60%	0.00%	0.20%	3.47%	0.82%	0.00%	9999000000	147380601				146bp	241bp	69.7%	0.0%	87.5%	83.6%	94.3%	227.0M	44.7%	97.5%	60239.6Mb	481.2M	54.6%	97.2%	57.4%
V4_0001_RNA_0005_23H5VFLT4_s30_1																																	141.6bp	86.8%	208.8M																79.6%	54%	151bp	151bp	36%	247.7M
V4_0001_RNA_0005_23H5VFLT4_s30_2																																																			78.4%	55%	151bp	151bp	27%	247.7M
V4_0001_RNA_0005_23H5VFLT4_s30_trimmed_1																																																			79.5%	54%	128bp	137bp	18%	240.6M	79.5%	54%	128bp	137bp	18%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s30_trimmed_2																																																			79.3%	54%	128bp	142bp	9%	240.6M	79.3%	54%	128bp	142bp	9%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s31	No	0.00%	585366648	0.01%	0.77%	136502630	0.58%	0.62%	0.38%	0.38%	79442765	40251272	51837437	25009009	142.34	35.00	0.51%	0.37%	0.98	0.000	140.9bp	132.0bp	0.09%	1.19%	0.58%	0.00%	0.16%	3.37%	0.79%	0.00%	9999000000	135808242				146bp	234bp	77.4%	0.0%	88.2%	83.8%	94.4%	276.3M	50.7%	97.5%	73692.3Mb	585.4M	55.2%	97.6%	58.4%
V4_0001_RNA_0005_23H5VFLT4_s31_1																																	140.9bp	87.5%	256.2M																83.1%	54%	151bp	151bp	27%	304.9M
V4_0001_RNA_0005_23H5VFLT4_s31_2																																																			81.3%	55%	151bp	151bp	18%	304.9M
V4_0001_RNA_0005_23H5VFLT4_s31_trimmed_1																																																			83.0%	54%	129bp	137bp	18%	292.7M	83.0%	54%	129bp	137bp	18%	292.7M
V4_0001_RNA_0005_23H5VFLT4_s31_trimmed_2																																																			82.3%	55%	129bp	137bp	9%	292.7M	82.3%	55%	129bp	137bp	9%	292.7M
V4_0001_RNA_0005_23H5VFLT4_s33	No	0.00%	588144222	0.01%	0.60%	237226986	0.79%	0.82%	0.19%	0.18%	187798244	95317107	46008247	21063791	379.59	96.00	0.58%	0.50%	0.98	0.000	152.2bp	138.0bp	0.15%	1.08%	0.78%	0.00%	0.27%	3.03%	1.01%	0.00%	9999000000	236654569				180bp	391bp	60.0%	0.0%	90.8%	87.7%	95.5%	280.9M	40.4%	97.6%	76112.4Mb	588.1M	53.9%	98.0%	48.6%
V4_0001_RNA_0005_23H5VFLT4_s33_1																																	152.2bp	90.3%	265.7M																81.6%	53%	151bp	151bp	27%	363.8M
V4_0001_RNA_0005_23H5VFLT4_s33_2																																																			80.8%	54%	151bp	151bp	18%	363.8M
V4_0001_RNA_0005_23H5VFLT4_s33_trimmed_1																																																			79.9%	53%	133bp	151bp	18%	294.1M	79.9%	53%	133bp	151bp	18%	294.1M
V4_0001_RNA_0005_23H5VFLT4_s33_trimmed_2																																																			80.3%	54%	133bp	151bp	18%	294.1M	80.3%	54%	133bp	151bp	18%	294.1M
V4_0001_RNA_0005_23H5VFLT4_s34	No	0.00%	585072442	0.01%	0.64%	211617914	0.76%	0.79%	0.22%	0.21%	160634262	81510131	46949027	21730424	320.60	82.00	0.57%	0.48%	0.98	0.000	150.6bp	137.0bp	0.14%	1.11%	0.73%	0.00%	0.25%	3.14%	0.97%	0.00%	9999000000	206018447				173bp	360bp	64.3%	0.0%	90.3%	86.4%	95.1%	278.2M	43.2%	97.6%	75449.7Mb	585.1M	54.1%	97.5%	49.5%
V4_0001_RNA_0005_23H5VFLT4_s34_1																																	150.6bp	89.7%	262.4M																81.5%	53%	151bp	151bp	27%	345.8M
V4_0001_RNA_0005_23H5VFLT4_s34_2																																																			80.6%	54%	151bp	151bp	18%	345.8M
V4_0001_RNA_0005_23H5VFLT4_s34_trimmed_1																																																			80.3%	53%	132bp	151bp	18%	292.5M	80.3%	53%	132bp	151bp	18%	292.5M
V4_0001_RNA_0005_23H5VFLT4_s34_trimmed_2																																																			80.7%	54%	132bp	151bp	18%	292.5M	80.7%	54%	132bp	151bp	18%	292.5M
V4_0001_RNA_0005_23H5VFLT4_s35	No	0.00%	463097980	0.01%	0.67%	150680863	0.72%	0.75%	0.26%	0.25%	107919657	54770422	39179892	18405057	209.22	51.00	0.54%	0.43%	0.98	0.000	148.0bp	135.0bp	0.11%	1.14%	0.69%	0.00%	0.20%	3.19%	0.91%	0.00%	9999000000	150509030				162bp	305bp	68.0%	0.0%	89.6%	84.8%	94.7%	219.2M	42.0%	97.6%	59380.0Mb	463.1M	55.1%	97.5%	52.2%
V4_0001_RNA_0005_23H5VFLT4_s35_1																																	148.0bp	88.8%	205.7M																80.4%	54%	151bp	151bp	27%	237.4M
V4_0001_RNA_0005_23H5VFLT4_s35_2																																																			79.0%	55%	151bp	151bp	27%	237.4M
V4_0001_RNA_0005_23H5VFLT4_s35_trimmed_1																																																			80.3%	54%	131bp	147bp	18%	231.5M	80.3%	54%	131bp	147bp	18%	231.5M
V4_0001_RNA_0005_23H5VFLT4_s35_trimmed_2																																																			80.0%	55%	131bp	147bp	9%	231.5M	80.0%	55%	131bp	147bp	9%	231.5M
V4_0001_RNA_0005_23H5VFLT4_s36	No	0.00%	557387630	0.01%	0.71%	164321105	0.66%	0.69%	0.31%	0.31%	108873876	55205369	50868399	24238824	204.68	53.00	0.54%	0.43%	0.98	0.000	143.8bp	132.0bp	0.12%	1.17%	0.65%	0.00%	0.22%	3.33%	0.86%	0.00%	9999000000	167290374				152bp	270bp	71.1%	0.0%	88.6%	85.2%	94.7%	264.0M	44.2%	97.6%	70382.8Mb	557.4M	54.3%	97.7%	55.5%
V4_0001_RNA_0005_23H5VFLT4_s36_1																																	143.8bp	88.0%	245.2M																81.3%	53%	151bp	151bp	27%	285.4M
V4_0001_RNA_0005_23H5VFLT4_s36_2																																																			79.8%	54%	151bp	151bp	18%	285.4M
V4_0001_RNA_0005_23H5VFLT4_s36_trimmed_1																																																			81.3%	54%	129bp	142bp	18%	278.7M	81.3%	54%	129bp	142bp	18%	278.7M
V4_0001_RNA_0005_23H5VFLT4_s36_trimmed_2																																																			80.8%	54%	129bp	142bp	9%	278.7M	80.8%	54%	129bp	142bp	9%	278.7M
V4_0001_RNA_0005_23H5VFLT4_s37	No	0.00%	545360364	0.01%	0.73%	145693123	0.62%	0.65%	0.35%	0.35%	89752563	45468421	51270840	24644283	163.99	42.00	0.53%	0.40%	0.98	0.000	140.8bp	130.0bp	0.12%	1.19%	0.62%	0.00%	0.21%	3.37%	0.83%	0.00%	9999000000	147167337				146bp	245bp	73.9%	0.0%	87.9%	84.8%	94.6%	258.0M	46.8%	97.6%	68356.5Mb	545.4M	54.3%	97.6%	57.6%
V4_0001_RNA_0005_23H5VFLT4_s37_1																																	140.8bp	87.3%	238.1M																81.8%	53%	151bp	151bp	27%	279.5M
V4_0001_RNA_0005_23H5VFLT4_s37_2																																																			80.2%	54%	151bp	151bp	27%	279.5M
V4_0001_RNA_0005_23H5VFLT4_s37_trimmed_1																																																			81.9%	54%	128bp	137bp	18%	272.7M	81.9%	54%	128bp	137bp	18%	272.7M
V4_0001_RNA_0005_23H5VFLT4_s37_trimmed_2																																																			81.3%	54%	128bp	137bp	9%	272.7M	81.3%	54%	128bp	137bp	9%	272.7M
V4_0001_RNA_0005_23H5VFLT4_s38	No	0.00%	528286358	0.01%	0.72%	148228308	0.63%	0.66%	0.34%	0.34%	92731207	46972571	50395119	24213503	167.42	43.00	0.53%	0.40%	0.98	0.000	138.7bp	128.0bp	0.11%	1.22%	0.61%	0.00%	0.20%	3.42%	0.82%	0.00%	9999000000	147843183				142bp	229bp	72.6%	0.0%	87.8%	83.0%	94.1%	248.6M	45.6%	97.5%	65416.7Mb	528.3M	55.1%	97.1%	59.5%
V4_0001_RNA_0005_23H5VFLT4_s38_1																																	138.7bp	86.9%	229.6M																81.0%	54%	151bp	151bp	27%	272.1M
V4_0001_RNA_0005_23H5VFLT4_s38_2																																																			79.7%	55%	151bp	151bp	36%	272.1M
V4_0001_RNA_0005_23H5VFLT4_s38_trimmed_1																																																			81.0%	54%	127bp	137bp	18%	264.1M	81.0%	54%	127bp	137bp	18%	264.1M
V4_0001_RNA_0005_23H5VFLT4_s38_trimmed_2																																																			80.8%	55%	127bp	137bp	9%	264.1M	80.8%	55%	127bp	137bp	9%	264.1M
V4_0001_RNA_0005_23H5VFLT4_s39	No	0.00%	494713366	0.01%	0.73%	133176882	0.61%	0.64%	0.36%	0.36%	81007949	41068610	47522656	22859158	147.43	37.00	0.52%	0.37%	0.97	0.000	141.5bp	131.0bp	0.11%	1.17%	0.58%	0.00%	0.20%	3.31%	0.79%	0.00%	9999000000	164101280				147bp	237bp	73.8%	0.0%	87.8%	83.9%	94.4%	233.4M	45.7%	97.3%	62036.5Mb	494.7M	55.1%	97.7%	57.4%
V4_0001_RNA_0005_23H5VFLT4_s39_1																																	141.5bp	87.1%	215.5M																80.8%	54%	151bp	151bp	27%	253.1M
V4_0001_RNA_0005_23H5VFLT4_s39_2																																																			79.5%	55%	151bp	151bp	18%	253.1M
V4_0001_RNA_0005_23H5VFLT4_s39_trimmed_1																																																			80.9%	54%	129bp	142bp	18%	247.4M	80.9%	54%	129bp	142bp	18%	247.4M
V4_0001_RNA_0005_23H5VFLT4_s39_trimmed_2																																																			80.7%	55%	129bp	142bp	9%	247.4M	80.7%	55%	129bp	142bp	9%	247.4M
V4_0001_RNA_0005_23H5VFLT4_s41	No	0.00%	587676760	0.01%	0.61%	229788401	0.79%	0.82%	0.19%	0.18%	181570430	92075388	44717744	20586719	361.72	88.00	0.57%	0.49%	0.98	0.000	149.1bp	136.0bp	0.16%	1.12%	0.81%	0.00%	0.29%	3.12%	1.05%	0.00%	9999000000	237569124				171bp	362bp	61.3%	0.0%	91.5%	87.2%	95.4%	280.2M	40.3%	97.5%	75001.0Mb	587.7M	54.6%	97.9%	51.2%
V4_0001_RNA_0005_23H5VFLT4_s41_1																																	149.1bp	90.7%	266.6M																83.3%	54%	151bp	151bp	27%	428.0M
V4_0001_RNA_0005_23H5VFLT4_s41_2																																																			82.6%	54%	151bp	151bp	18%	428.0M
V4_0001_RNA_0005_23H5VFLT4_s41_trimmed_1																																																			80.5%	54%	131bp	147bp	27%	293.8M	80.5%	54%	131bp	147bp	27%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s41_trimmed_2																																																			81.0%	54%	131bp	147bp	18%	293.8M	81.0%	54%	131bp	147bp	18%	293.8M
V4_0001_RNA_0005_23H5VFLT4_s42	No	0.00%	586993272	0.01%	0.65%	206202178	0.75%	0.78%	0.23%	0.22%	154948632	78634948	47209576	21895693	307.07	77.00	0.57%	0.48%	0.98	0.000	150.6bp	137.0bp	0.13%	1.10%	0.73%	0.00%	0.24%	3.12%	0.97%	0.00%	9999000000	206842433				172bp	355bp	65.3%	0.0%	90.3%	86.5%	95.1%	279.1M	43.7%	97.5%	75640.4Mb	587.0M	54.3%	97.8%	49.9%
V4_0001_RNA_0005_23H5VFLT4_s42_1																																	150.6bp	89.7%	263.3M																82.5%	53%	151bp	151bp	27%	367.7M
V4_0001_RNA_0005_23H5VFLT4_s42_2																																																			81.5%	54%	151bp	151bp	18%	367.7M
V4_0001_RNA_0005_23H5VFLT4_s42_trimmed_1																																																			80.8%	54%	132bp	151bp	18%	293.5M	80.8%	54%	132bp	151bp	18%	293.5M
V4_0001_RNA_0005_23H5VFLT4_s42_trimmed_2																																																			81.1%	54%	132bp	151bp	18%	293.5M	81.1%	54%	132bp	151bp	18%	293.5M
V4_0001_RNA_0005_23H5VFLT4_s43	No	0.00%	586465098	0.01%	0.71%	169082773	0.68%	0.71%	0.30%	0.29%	114724720	58171718	50008951	23732537	215.61	54.00	0.54%	0.44%	0.98	0.000	144.2bp	131.0bp	0.13%	1.17%	0.70%	0.00%	0.24%	3.28%	0.92%	0.00%	9999000000	163421064				155bp	291bp	71.7%	0.0%	89.2%	85.6%	94.9%	278.2M	47.4%	97.6%	73946.0Mb	586.5M	54.2%	97.7%	54.8%
V4_0001_RNA_0005_23H5VFLT4_s43_1																																	144.2bp	88.6%	259.8M																83.3%	53%	151bp	151bp	27%	355.2M
V4_0001_RNA_0005_23H5VFLT4_s43_2																																																			81.9%	54%	151bp	151bp	18%	355.2M
V4_0001_RNA_0005_23H5VFLT4_s43_trimmed_1																																																			82.0%	53%	129bp	142bp	18%	293.2M	82.0%	53%	129bp	142bp	18%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s43_trimmed_2																																																			81.8%	54%	129bp	142bp	18%	293.2M	81.8%	54%	129bp	142bp	18%	293.2M
V4_0001_RNA_0005_23H5VFLT4_s44	No	0.00%	540826240	0.01%	0.70%	162677663	0.67%	0.70%	0.30%	0.30%	108864764	55173026	49254945	23465907	201.66	52.00	0.54%	0.43%	0.98	0.000	142.0bp	130.0bp	0.12%	1.20%	0.66%	0.00%	0.23%	3.38%	0.88%	0.00%	9999000000	164591990				147bp	256bp	70.5%	0.0%	88.7%	84.2%	94.5%	255.5M	43.8%	97.5%	67442.2Mb	540.8M	54.6%	97.3%	57.3%
V4_0001_RNA_0005_23H5VFLT4_s44_1																																	142.0bp	87.9%	237.8M																81.1%	54%	151bp	151bp	27%	278.0M
V4_0001_RNA_0005_23H5VFLT4_s44_2																																																			80.0%	55%	151bp	151bp	27%	278.0M
V4_0001_RNA_0005_23H5VFLT4_s44_trimmed_1																																																			81.1%	54%	128bp	137bp	18%	270.4M	81.1%	54%	128bp	137bp	18%	270.4M
V4_0001_RNA_0005_23H5VFLT4_s44_trimmed_2																																																			80.9%	54%	128bp	137bp	9%	270.4M	80.9%	54%	128bp	137bp	9%	270.4M
V4_0001_RNA_0005_23H5VFLT4_s45	No	0.00%	557707196	0.01%	0.75%	139623794	0.60%	0.63%	0.37%	0.37%	83321479	42179178	51224064	24716275	147.25	36.00	0.52%	0.38%	0.98	0.000	135.9bp	126.0bp	0.12%	1.23%	0.64%	0.00%	0.21%	3.45%	0.86%	0.00%	9999000000	140224967				138bp	222bp	75.7%	0.0%	88.2%	83.5%	94.3%	263.0M	47.4%	97.5%	68307.1Mb	557.7M	54.9%	97.1%	61.6%
V4_0001_RNA_0005_23H5VFLT4_s45_1																																	135.9bp	87.4%	243.7M																82.6%	54%	151bp	151bp	27%	287.2M
V4_0001_RNA_0005_23H5VFLT4_s45_2																																																			80.8%	55%	151bp	151bp	36%	287.2M
V4_0001_RNA_0005_23H5VFLT4_s45_trimmed_1																																																			82.5%	54%	126bp	132bp	18%	278.9M	82.5%	54%	126bp	132bp	18%	278.9M
V4_0001_RNA_0005_23H5VFLT4_s45_trimmed_2																																																			81.9%	55%	126bp	132bp	9%	278.9M	81.9%	55%	126bp	132bp	9%	278.9M
V4_0001_RNA_0005_23H5VFLT4_s46	No	0.00%	469384996	0.01%	0.70%	139855169	0.64%	0.67%	0.33%	0.33%	89211888	45203564	46258955	22176812	162.26	41.00	0.53%	0.39%	0.98	0.000	139.5bp	129.0bp	0.11%	1.21%	0.61%	0.00%	0.20%	3.41%	0.83%	0.00%	9999000000	147309160				144bp	234bp	70.9%	0.0%	87.6%	83.2%	94.2%	221.0M	44.0%	97.5%	58332.4Mb	469.4M	55.0%	97.5%	58.5%
V4_0001_RNA_0005_23H5VFLT4_s46_1																																	139.5bp	86.8%	203.8M																79.9%	54%	151bp	151bp	27%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s46_2																																																			78.6%	55%	151bp	151bp	27%	240.6M
V4_0001_RNA_0005_23H5VFLT4_s46_trimmed_1																																																			79.9%	54%	127bp	137bp	18%	234.7M	79.9%	54%	127bp	137bp	18%	234.7M
V4_0001_RNA_0005_23H5VFLT4_s46_trimmed_2																																																			79.7%	55%	128bp	137bp	9%	234.7M	79.7%	55%	128bp	137bp	9%	234.7M
V4_0001_RNA_0005_23H5VFLT4_s47	No	0.00%	582809834	0.01%	0.77%	135323544	0.56%	0.60%	0.39%	0.40%	76175566	38550446	53387109	25820182	132.90	33.00	0.51%	0.35%	0.98	0.000	135.5bp	126.0bp	0.11%	1.23%	0.61%	0.00%	0.19%	3.45%	0.82%	0.00%	9999000000	136215416				137bp	213bp	77.5%	0.0%	87.7%	82.7%	94.0%	273.9M	48.4%	97.5%	71276.3Mb	582.8M	55.3%	97.1%	62.2%
V4_0001_RNA_0005_23H5VFLT4_s47_1																																	135.5bp	86.9%	253.3M																83.1%	54%	151bp	151bp	27%	301.9M
V4_0001_RNA_0005_23H5VFLT4_s47_2																																																			81.5%	55%	151bp	151bp	36%	301.9M
V4_0001_RNA_0005_23H5VFLT4_s47_trimmed_1																																																			83.0%	55%	125bp	132bp	18%	291.4M	83.0%	55%	125bp	132bp	18%	291.4M
V4_0001_RNA_0005_23H5VFLT4_s47_trimmed_2																																																			82.6%	55%	126bp	132bp	9%	291.4M	82.6%	55%	126bp	132bp	9%	291.4M
tih_rna_sample_00087_23H5VFLT4_s17	No	0.00%	594886636	0.01%	0.42%	344923061	0.84%	0.86%	0.15%	0.14%	289473809	146453780	52330790	24036505	571.70	272.00	0.72%	0.62%	0.98	0.000	147.7bp	137.0bp	0.15%	1.17%	0.50%	0.00%	0.35%	3.64%	0.70%	0.00%	9999000000	519814896				161bp	311bp	42.2%	0.0%	90.8%	89.0%	95.7%	284.5M	28.9%	97.7%	76259.9Mb	594.9M	52.5%	99.1%	53.0%
tih_rna_sample_00087_23H5VFLT4_s17_1																																	147.7bp	91.5%	272.1M																79.5%	52%	151bp	151bp	27%	413.7M
tih_rna_sample_00087_23H5VFLT4_s17_2																																																			78.9%	52%	151bp	151bp	18%	413.7M
tih_rna_sample_00087_23H5VFLT4_s17_trimmed_1																																																			77.2%	52%	131bp	147bp	18%	297.4M	77.2%	52%	131bp	147bp	18%	297.4M
tih_rna_sample_00087_23H5VFLT4_s17_trimmed_2																																																			77.1%	52%	131bp	147bp	9%	297.4M	77.1%	52%	131bp	147bp	9%	297.4M
tih_rna_sample_00088_23H5VFLT4_s02	Yes	0.00%	592590250	0.01%	0.57%	255047414	0.85%	0.87%	0.14%	0.13%	216062376	109109942	34967670	16012680	401.67	187.00	0.73%	0.61%	0.98	0.000	138.1bp	128.0bp	0.05%	0.35%	0.32%	0.00%	0.12%	1.22%	0.55%	0.00%	9990000000	291848208				162bp	301bp	57.3%	0.0%	93.5%	88.1%	95.7%	283.5M	36.2%	97.5%	73672.9Mb	592.6M	58.3%	98.8%	60.5%
tih_rna_sample_00088_23H5VFLT4_s02_1																																	138.1bp	93.8%	278.0M																81.3%	57%	151bp	151bp	27%	412.7M
tih_rna_sample_00088_23H5VFLT4_s02_2																																																			80.7%	57%	151bp	151bp	27%	412.7M
tih_rna_sample_00088_23H5VFLT4_s02_trimmed_1																																																			78.6%	58%	128bp	137bp	27%	296.3M	78.6%	58%	128bp	137bp	27%	296.3M
tih_rna_sample_00088_23H5VFLT4_s02_trimmed_2																																																			78.8%	58%	128bp	137bp	18%	296.3M	78.8%	58%	128bp	137bp	18%	296.3M
tih_rna_sample_00089_23H5VFLT4_s39	No	0.00%	593769956	0.00%	0.48%	310289111	0.87%	0.89%	0.12%	0.11%	269406432	136339948	37921175	16876195	533.34	256.00	0.73%	0.63%	0.98	0.000	148.5bp	139.0bp	0.18%	0.98%	0.49%	0.00%	0.40%	3.02%	0.73%	0.00%	9999000000	386646400				173bp	365bp	48.0%	0.0%	93.3%	88.8%	95.8%	284.5M	33.5%	97.6%	76661.6Mb	593.8M	55.4%	99.0%	52.4%
tih_rna_sample_00089_23H5VFLT4_s39_1																																	148.5bp	93.8%	278.5M																81.6%	54%	151bp	151bp	27%	390.3M
tih_rna_sample_00089_23H5VFLT4_s39_2																																																			81.1%	55%	151bp	151bp	18%	390.3M
tih_rna_sample_00089_23H5VFLT4_s39_trimmed_1																																																			79.6%	55%	132bp	147bp	18%	296.9M	79.6%	55%	132bp	147bp	18%	296.9M
tih_rna_sample_00089_23H5VFLT4_s39_trimmed_2																																																			79.9%	55%	132bp	147bp	9%	296.9M	79.9%	55%	132bp	147bp	9%	296.9M
tih_rna_sample_00090_23H5VFLT4_s32	Yes	0.00%	592230264	0.01%	0.55%	267639473	0.85%	0.88%	0.13%	0.12%	227564046	114669887	33621119	15505105	384.48	112.00	0.66%	0.52%	0.98	0.000	125.7bp	120.0bp	0.10%	0.91%	0.51%	0.00%	0.18%	2.58%	0.72%	0.00%	9999000000	295128414				130bp	194bp	55.4%	0.0%	93.9%	80.9%	93.2%	276.0M	31.9%	97.4%	69839.2Mb	592.2M	59.7%	98.7%	71.3%
tih_rna_sample_00090_23H5VFLT4_s32_1																																	125.7bp	93.2%	276.0M																80.0%	57%	151bp	151bp	27%	352.9M
tih_rna_sample_00090_23H5VFLT4_s32_2																																																			79.6%	58%	151bp	151bp	36%	352.9M
tih_rna_sample_00090_23H5VFLT4_s32_trimmed_1																																																			78.7%	59%	121bp	122bp	18%	296.1M	78.7%	59%	121bp	122bp	18%	296.1M
tih_rna_sample_00090_23H5VFLT4_s32_trimmed_2																																																			79.1%	59%	121bp	127bp	9%	296.1M	79.1%	59%	121bp	127bp	9%	296.1M
tih_rna_sample_00096_23H5VFLT4_s11	No	0.00%	594161250	0.01%	0.46%	318909879	0.84%	0.87%	0.15%	0.13%	269417597	136311265	46447262	21217438	521.75	269.00	0.76%	0.65%	0.98	0.000	144.9bp	135.0bp	0.21%	0.53%	0.29%	0.00%	0.44%	1.65%	0.42%	0.00%	9999000000	399199690				156bp	281bp	46.6%	0.0%	91.8%	89.6%	96.1%	285.4M	32.0%	97.7%	75717.2Mb	594.2M	54.5%	99.0%	55.1%
tih_rna_sample_00096_23H5VFLT4_s11_1																																	144.9bp	92.2%	273.9M																77.4%	53%	151bp	151bp	27%	308.6M
tih_rna_sample_00096_23H5VFLT4_s11_2																																																			76.8%	54%	151bp	151bp	18%	308.6M
tih_rna_sample_00096_23H5VFLT4_s11_trimmed_1																																																			77.3%	54%	130bp	142bp	18%	297.1M	77.3%	54%	130bp	142bp	18%	297.1M
tih_rna_sample_00096_23H5VFLT4_s11_trimmed_2																																																			77.2%	54%	130bp	142bp	9%	297.1M	77.2%	54%	130bp	142bp	9%	297.1M
tih_rna_sample_00097_23H5VFLT4_s12	No	0.00%	594403842	0.01%	0.51%	293024134	0.84%	0.86%	0.15%	0.14%	246472790	124408967	43529316	20269309	438.14	198.00	0.71%	0.60%	0.98	0.000	131.5bp	124.0bp	0.25%	1.79%	0.64%	0.00%	0.47%	4.91%	0.87%	0.00%	9999000000	366059375				142bp	286bp	51.0%	0.0%	92.6%	87.4%	95.4%	283.5M	31.5%	97.6%	72143.5Mb	594.4M	52.5%	99.1%	66.6%
tih_rna_sample_00097_23H5VFLT4_s12_1																																	131.5bp	92.5%	274.9M																80.0%	52%	151bp	151bp	27%	364.2M
tih_rna_sample_00097_23H5VFLT4_s12_2																																																			79.3%	52%	151bp	151bp	18%	364.2M
tih_rna_sample_00097_23H5VFLT4_s12_trimmed_1																																																			78.5%	52%	124bp	132bp	18%	297.2M	78.5%	52%	124bp	132bp	18%	297.2M
tih_rna_sample_00097_23H5VFLT4_s12_trimmed_2																																																			78.4%	52%	124bp	132bp	9%	297.2M	78.4%	52%	124bp	132bp	9%	297.2M
tih_rna_sample_00104_23H5VFLT4_s20	No	0.00%	414319340	0.01%	0.77%	95368014	0.59%	0.63%	0.35%	0.37%	55850573	28093390	33807248	16554869	80.37	28.00	0.49%	0.23%	0.98	0.000	117.8bp	114.0bp	0.27%	0.60%	0.28%	0.00%	0.56%	1.84%	0.43%	0.00%	9999000000	109558403				118bp	145bp	78.1%	0.0%	89.9%	78.3%	92.7%	192.0M	46.4%	97.4%	46841.5Mb	414.3M	58.8%	98.3%	79.9%
tih_rna_sample_00104_23H5VFLT4_s20_1																																	117.8bp	89.1%	184.6M																80.4%	56%	151bp	151bp	27%	210.8M
tih_rna_sample_00104_23H5VFLT4_s20_2																																																			79.0%	57%	151bp	151bp	27%	210.8M
tih_rna_sample_00104_23H5VFLT4_s20_trimmed_1																																																			80.5%	58%	116bp	117bp	18%	207.2M	80.5%	58%	116bp	117bp	18%	207.2M
tih_rna_sample_00104_23H5VFLT4_s20_trimmed_2																																																			79.9%	58%	116bp	117bp	9%	207.2M	79.9%	58%	116bp	117bp	9%	207.2M
tih_rna_sample_00105_23H5VFLT4_s21	No	0.00%	110239562	0.02%	0.65%	38968469	0.44%	0.47%	0.51%	0.53%	17314875	8691792	19952434	9893525	21.63	8.00	0.21%	0.04%	0.98	0.000	102.6bp	100.0bp	0.23%	0.48%	0.27%	0.00%	0.49%	1.50%	0.39%	0.00%	9999000000	62502539				101bp	112bp	65.7%	0.0%	79.7%	75.1%	91.6%	50.5M	31.5%	97.6%	11139.4Mb	110.2M	53.6%	97.2%	89.4%
tih_rna_sample_00105_23H5VFLT4_s21_1																																	102.6bp	79.2%	43.7M																67.9%	53%	151bp	151bp	36%	56.7M
tih_rna_sample_00105_23H5VFLT4_s21_2																																																			66.5%	54%	151bp	151bp	45%	56.7M
tih_rna_sample_00105_23H5VFLT4_s21_trimmed_1																																																			67.3%	53%	104bp	102bp	18%	55.1M	67.3%	53%	104bp	102bp	18%	55.1M
tih_rna_sample_00105_23H5VFLT4_s21_trimmed_2																																																			66.5%	53%	104bp	102bp	9%	55.1M	66.5%	53%	104bp	102bp	9%	55.1M
tih_rna_sample_00111_23H5VFLT4_s30	No	0.00%	337195840	0.01%	0.73%	90687111	0.54%	0.57%	0.42%	0.43%	48877382	24636871	37723194	18518352	76.35	35.00	0.53%	0.23%	0.98	0.000	126.9bp	121.0bp	0.09%	0.68%	0.21%	0.00%	0.21%	2.22%	0.34%	0.00%	9999000000	112596413				127bp	158bp	74.0%	0.0%	86.3%	83.2%	94.0%	158.4M	48.9%	97.5%	40437.9Mb	337.2M	55.2%	98.6%	71.2%
tih_rna_sample_00111_23H5VFLT4_s30_1																																	126.9bp	86.4%	145.7M																77.9%	54%	151bp	151bp	27%	171.0M
tih_rna_sample_00111_23H5VFLT4_s30_2																																																			76.4%	55%	151bp	151bp	18%	171.0M
tih_rna_sample_00111_23H5VFLT4_s30_trimmed_1																																																			78.0%	55%	123bp	127bp	18%	168.6M	78.0%	55%	123bp	127bp	18%	168.6M
tih_rna_sample_00111_23H5VFLT4_s30_trimmed_2																																																			77.1%	55%	123bp	127bp	9%	168.6M	77.1%	55%	123bp	127bp	9%	168.6M
tih_rna_sample_00115_23H5VFLT4_s35	No	0.00%	497553714	0.01%	0.70%	148909926	0.67%	0.69%	0.31%	0.31%	99034544	49818900	45491055	22238628	146.93	67.00	0.64%	0.41%	0.98	0.000	114.0bp	109.0bp	0.12%	0.34%	0.38%	0.00%	0.26%	1.14%	0.58%	0.00%	9999000000	168054302				115bp	154bp	70.7%	0.0%	89.8%	83.9%	94.5%	235.0M	41.4%	97.6%	55008.4Mb	497.6M	55.5%	98.8%	81.2%
tih_rna_sample_00115_23H5VFLT4_s35_1																																	114.0bp	89.7%	223.2M																78.7%	54%	151bp	151bp	27%	251.8M
tih_rna_sample_00115_23H5VFLT4_s35_2																																																			77.5%	55%	151bp	151bp	36%	251.8M
tih_rna_sample_00115_23H5VFLT4_s35_trimmed_1																																																			78.8%	55%	113bp	112bp	18%	248.8M	78.8%	55%	113bp	112bp	18%	248.8M
tih_rna_sample_00115_23H5VFLT4_s35_trimmed_2																																																			78.2%	55%	113bp	112bp	9%	248.8M	78.2%	55%	113bp	112bp	9%	248.8M
tih_rna_sample_00116_23H5VFLT4_s36	No	0.00%	592885738	0.01%	0.56%	258836966	0.83%	0.85%	0.16%	0.15%	213704901	107672244	41026095	19351109	353.92	165.00	0.72%	0.59%	0.98	0.000	123.5bp	117.0bp	0.18%	0.98%	0.62%	0.00%	0.32%	2.75%	0.83%	0.00%	9999000000	283466965				125bp	196bp	56.7%	0.0%	93.0%	87.3%	95.3%	282.4M	32.4%	97.6%	69117.6Mb	592.9M	55.0%	98.8%	73.9%
tih_rna_sample_00116_23H5VFLT4_s36_1																																	123.5bp	92.5%	274.2M																80.5%	54%	151bp	151bp	27%	354.2M
tih_rna_sample_00116_23H5VFLT4_s36_2																																																			79.5%	54%	151bp	151bp	27%	354.2M
tih_rna_sample_00116_23H5VFLT4_s36_trimmed_1																																																			79.2%	54%	119bp	122bp	18%	296.4M	79.2%	54%	119bp	122bp	18%	296.4M
tih_rna_sample_00116_23H5VFLT4_s36_trimmed_2																																																			78.9%	55%	119bp	122bp	9%	296.4M	78.9%	55%	119bp	122bp	9%	296.4M
tih_rna_sample_00117_23H5VFLT4_s37	No	0.00%	414808524	0.01%	0.78%	90101202	0.61%	0.64%	0.35%	0.36%	55325345	27896838	31674119	15403765	93.40	43.00	0.57%	0.28%	0.98	0.000	131.4bp	124.0bp	0.13%	0.48%	0.33%	0.00%	0.27%	1.59%	0.51%	0.00%	9999000000	103307071				136bp	206bp	78.9%	0.0%	91.0%	86.6%	95.2%	197.3M	52.3%	97.6%	50484.5Mb	414.8M	55.9%	98.6%	67.0%
tih_rna_sample_00117_23H5VFLT4_s37_1																																	131.4bp	90.9%	188.5M																82.4%	54%	151bp	151bp	27%	210.4M
tih_rna_sample_00117_23H5VFLT4_s37_2																																																			81.0%	55%	151bp	151bp	18%	210.4M
tih_rna_sample_00117_23H5VFLT4_s37_trimmed_1																																																			82.5%	55%	125bp	132bp	18%	207.4M	82.5%	55%	125bp	132bp	18%	207.4M
tih_rna_sample_00117_23H5VFLT4_s37_trimmed_2																																																			81.9%	56%	125bp	132bp	9%	207.4M	81.9%	56%	125bp	132bp	9%	207.4M
tih_rna_sample_00118_23H5VFLT4_s38	No	0.00%	593500366	0.01%	0.49%	305036020	0.86%	0.88%	0.13%	0.12%	263339421	133229612	38629318	17329595	504.28	240.00	0.73%	0.62%	0.98	0.000	142.3bp	132.0bp	0.35%	1.42%	0.51%	0.00%	0.79%	4.22%	0.76%	0.00%	9999000000	377808036				159bp	326bp	48.9%	0.0%	93.3%	88.5%	95.8%	284.4M	33.1%	97.7%	75058.2Mb	593.5M	54.7%	98.9%	57.3%
tih_rna_sample_00118_23H5VFLT4_s38_1																																	142.3bp	93.4%	277.1M																80.8%	54%	151bp	151bp	27%	338.0M
tih_rna_sample_00118_23H5VFLT4_s38_2																																																			79.9%	54%	151bp	151bp	18%	338.0M
tih_rna_sample_00118_23H5VFLT4_s38_trimmed_1																																																			80.0%	54%	129bp	142bp	18%	296.8M	80.0%	54%	129bp	142bp	18%	296.8M
tih_rna_sample_00118_23H5VFLT4_s38_trimmed_2																																																			79.8%	54%	129bp	142bp	9%	296.8M	79.8%	54%	129bp	142bp	9%	296.8M
tih_rna_sample_00121_23H5VFLT4_s41	No	0.00%	592862082	0.01%	0.54%	270842443	0.78%	0.81%	0.20%	0.19%	211432915	106741130	54298704	25767445	369.02	189.00	0.75%	0.62%	0.98	0.000	129.9bp	122.0bp	0.17%	0.61%	0.32%	0.00%	0.40%	1.97%	0.50%	0.00%	9999000000	312653453				135bp	208bp	54.8%	0.0%	89.8%	85.5%	94.8%	281.1M	33.4%	97.5%	71337.4Mb	592.9M	56.2%	98.8%	66.7%
tih_rna_sample_00121_23H5VFLT4_s41_1																																	129.9bp	89.8%	266.1M																77.4%	55%	151bp	151bp	36%	309.5M
tih_rna_sample_00121_23H5VFLT4_s41_2																																																			76.8%	55%	151bp	151bp	27%	309.5M
tih_rna_sample_00121_23H5VFLT4_s41_trimmed_1																																																			77.2%	56%	123bp	127bp	27%	296.4M	77.2%	56%	123bp	127bp	27%	296.4M
tih_rna_sample_00121_23H5VFLT4_s41_trimmed_2																																																			77.3%	56%	123bp	127bp	18%	296.4M	77.3%	56%	123bp	127bp	18%	296.4M
tih_rna_sample_00122_23H5VFLT4_s42	No	0.00%	424453366	0.01%	0.55%	189510223	0.69%	0.71%	0.29%	0.29%	131272400	66066271	54929542	26806312	205.09	97.00	0.67%	0.49%	0.98	0.000	118.8bp	113.0bp	0.30%	0.85%	0.32%	0.00%	0.62%	2.63%	0.46%	0.00%	9999000000	231639256				117bp	147bp	55.8%	0.0%	85.7%	83.3%	94.3%	200.2M	31.6%	97.7%	48279.7Mb	424.5M	52.8%	98.8%	77.4%
tih_rna_sample_00122_23H5VFLT4_s42_1																																	118.8bp	86.1%	182.7M																71.2%	52%	151bp	151bp	27%	214.8M
tih_rna_sample_00122_23H5VFLT4_s42_2																																																			70.2%	53%	151bp	151bp	36%	214.8M
tih_rna_sample_00122_23H5VFLT4_s42_trimmed_1																																																			71.2%	52%	116bp	117bp	18%	212.2M	71.2%	52%	116bp	117bp	18%	212.2M
tih_rna_sample_00122_23H5VFLT4_s42_trimmed_2																																																			70.8%	52%	116bp	117bp	9%	212.2M	70.8%	52%	116bp	117bp	9%	212.2M
tih_rna_sample_00124_23H5VFLT4_s31	Yes	0.06%	593814778	0.01%	0.48%	311682260	0.84%	0.86%	0.15%	0.14%	262407744	132829591	45535379	20736914	512.97	283.00	0.78%	0.66%	0.98	0.000	145.3bp	135.0bp	0.10%	0.69%	0.37%	0.00%	0.23%	2.27%	0.58%	0.00%	9999000000	394985973				169bp	339bp	47.8%	0.0%	91.6%	89.6%	95.9%	284.6M	32.6%	97.7%	75909.9Mb	593.8M	53.8%	99.0%	53.9%
tih_rna_sample_00124_23H5VFLT4_s31_1																																	145.3bp	91.9%	272.9M																77.9%	53%	151bp	151bp	27%	350.8M
tih_rna_sample_00124_23H5VFLT4_s31_2																																																			77.7%	53%	151bp	151bp	18%	350.8M
tih_rna_sample_00124_23H5VFLT4_s31_trimmed_1																																																			76.6%	53%	131bp	147bp	18%	296.9M	76.6%	53%	131bp	147bp	18%	296.9M
tih_rna_sample_00124_23H5VFLT4_s31_trimmed_2																																																			77.0%	54%	131bp	147bp	9%	296.9M	77.0%	54%	131bp	147bp	9%	296.9M
tih_rna_sample_00127_23H5VFLT4_s08	No	0.00%	456491162	0.01%	0.56%	202675940	0.78%	0.80%	0.21%	0.20%	157537463	79397534	41893053	20064936	257.55	134.00	0.71%	0.56%	0.98	0.000	121.6bp	115.0bp	0.20%	1.01%	0.36%	0.00%	0.42%	3.08%	0.54%	0.00%	9999000000	232503664				122bp	180bp	56.0%	0.0%	90.3%	86.2%	95.0%	216.9M	31.6%	97.7%	52864.3Mb	456.5M	53.9%	98.8%	74.2%
tih_rna_sample_00127_23H5VFLT4_s08_1																																	121.6bp	90.4%	206.2M																74.2%	53%	151bp	151bp	27%	230.9M
tih_rna_sample_00127_23H5VFLT4_s08_2																																																			72.8%	53%	151bp	151bp	36%	230.9M
tih_rna_sample_00127_23H5VFLT4_s08_trimmed_1																																																			74.2%	53%	118bp	122bp	18%	228.2M	74.2%	53%	118bp	122bp	18%	228.2M
tih_rna_sample_00127_23H5VFLT4_s08_trimmed_2																																																			73.4%	54%	119bp	122bp	9%	228.2M	73.4%	54%	119bp	122bp	9%	228.2M
tih_rna_sample_00163_23H5VFLT4_s43	No	0.00%	594144994	0.01%	0.49%	301200404	0.84%	0.86%	0.15%	0.14%	252149416	127522159	45976822	21145012	479.31	247.00	0.76%	0.64%	0.98	0.000	141.1bp	130.0bp	0.21%	0.99%	0.38%	0.00%	0.44%	3.09%	0.57%	0.00%	9999000000	381734066				154bp	293bp	49.6%	0.0%	91.8%	89.9%	96.1%	285.4M	33.1%	97.7%	74602.7Mb	594.1M	53.6%	99.0%	58.0%
tih_rna_sample_00163_23H5VFLT4_s43_1																																	141.1bp	92.2%	273.9M																81.2%	53%	151bp	151bp	27%	400.7M
tih_rna_sample_00163_23H5VFLT4_s43_2																																																			80.3%	53%	151bp	151bp	18%	400.7M
tih_rna_sample_00163_23H5VFLT4_s43_trimmed_1																																																			79.0%	53%	128bp	137bp	18%	297.1M	79.0%	53%	128bp	137bp	18%	297.1M
tih_rna_sample_00163_23H5VFLT4_s43_trimmed_2																																																			78.8%	53%	129bp	137bp	9%	297.1M	78.8%	53%	129bp	137bp	9%	297.1M
tih_rna_sample_00218_23H5VFLT4_s10	No	0.00%	594789112	0.00%	0.47%	316088117	0.89%	0.91%	0.10%	0.09%	280035734	141611749	33103775	14545401	554.06	257.00	0.74%	0.63%	0.98	0.000	148.0bp	137.0bp	0.15%	0.64%	0.44%	0.00%	0.33%	2.10%	0.67%	0.00%	9999000000	436178224				173bp	419bp	47.1%	0.0%	94.7%	90.3%	96.2%	286.1M	31.9%	97.8%	76198.3Mb	594.8M	53.8%	99.1%	53.8%
tih_rna_sample_00218_23H5VFLT4_s10_1																																	148.0bp	94.8%	281.9M																80.7%	53%	151bp	151bp	27%	348.9M
tih_rna_sample_00218_23H5VFLT4_s10_2																																																			80.5%	53%	151bp	151bp	18%	348.9M
tih_rna_sample_00218_23H5VFLT4_s10_trimmed_1																																																			79.7%	53%	131bp	147bp	18%	297.4M	79.7%	53%	131bp	147bp	18%	297.4M
tih_rna_sample_00218_23H5VFLT4_s10_trimmed_2																																																			80.0%	54%	131bp	147bp	9%	297.4M	80.0%	54%	131bp	147bp	9%	297.4M
tih_rna_sample_00220_23H5VFLT4_s16	No	0.00%	593946606	0.01%	0.67%	197629747	0.78%	0.80%	0.20%	0.20%	153504835	77611240	40392609	19044237	281.87	133.00	0.71%	0.55%	0.98	0.000	140.2bp	131.0bp	0.11%	0.57%	0.26%	0.00%	0.24%	1.95%	0.43%	0.00%	9999000000	195310590				155bp	267bp	67.1%	0.0%	92.0%	88.7%	95.8%	284.5M	45.9%	97.6%	74863.5Mb	593.9M	56.7%	99.0%	59.2%
tih_rna_sample_00220_23H5VFLT4_s16_1																																	140.2bp	92.3%	274.0M																79.9%	55%	151bp	151bp	27%	310.8M
tih_rna_sample_00220_23H5VFLT4_s16_2																																																			79.2%	56%	151bp	151bp	18%	310.8M
tih_rna_sample_00220_23H5VFLT4_s16_trimmed_1																																																			79.7%	56%	129bp	137bp	27%	297.0M	79.7%	56%	129bp	137bp	27%	297.0M
tih_rna_sample_00220_23H5VFLT4_s16_trimmed_2																																																			79.5%	56%	129bp	137bp	9%	297.0M	79.5%	56%	129bp	137bp	9%	297.0M
tih_rna_sample_00235_23H5VFLT4_s07	No	0.00%	594362692	0.01%	0.44%	334204454	0.87%	0.90%	0.12%	0.10%	291853361	147778570	38980406	17218919	573.85	295.00	0.78%	0.67%	0.98	0.000	146.3bp	135.0bp	0.11%	0.88%	0.32%	0.00%	0.23%	2.62%	0.50%	0.00%	9999000000	474190114				169bp	366bp	44.0%	0.0%	93.4%	89.5%	96.0%	285.2M	30.0%	97.8%	76250.8Mb	594.4M	54.0%	99.1%	53.3%
tih_rna_sample_00235_23H5VFLT4_s07_1																																	146.3bp	93.4%	277.4M																81.6%	53%	151bp	151bp	27%	492.6M
tih_rna_sample_00235_23H5VFLT4_s07_2																																																			81.3%	54%	151bp	151bp	18%	492.6M
tih_rna_sample_00235_23H5VFLT4_s07_trimmed_1																																																			77.9%	53%	131bp	147bp	18%	297.2M	77.9%	53%	131bp	147bp	18%	297.2M
tih_rna_sample_00235_23H5VFLT4_s07_trimmed_2																																																			78.3%	54%	131bp	147bp	9%	297.2M	78.3%	54%	131bp	147bp	9%	297.2M
tih_rna_sample_00248_23H5VFLT4_s01	No	0.00%	593763468	0.01%	0.49%	300603117	0.84%	0.86%	0.15%	0.14%	251275546	126928411	45908620	21282705	464.01	223.00	0.72%	0.61%	0.98	0.000	136.4bp	127.0bp	0.19%	0.96%	0.35%	0.00%	0.38%	2.95%	0.54%	0.00%	9999000000	355751405				143bp	243bp	49.7%	0.0%	92.0%	87.6%	95.3%	283.1M	30.6%	97.6%	73645.7Mb	593.8M	54.2%	99.0%	61.4%
tih_rna_sample_00248_23H5VFLT4_s01_1																																	136.4bp	92.3%	274.0M																75.4%	53%	151bp	151bp	27%	308.1M
tih_rna_sample_00248_23H5VFLT4_s01_2																																																			74.8%	54%	151bp	151bp	18%	308.1M
tih_rna_sample_00248_23H5VFLT4_s01_trimmed_1																																																			75.2%	54%	127bp	137bp	18%	296.9M	75.2%	54%	127bp	137bp	18%	296.9M
tih_rna_sample_00248_23H5VFLT4_s01_trimmed_2																																																			75.2%	54%	127bp	137bp	9%	296.9M	75.2%	54%	127bp	137bp	9%	296.9M
tih_rna_sample_00251_23H5VFLT4_s03	No	0.00%	593103684	0.01%	0.54%	274743689	0.81%	0.83%	0.18%	0.17%	221517190	111992123	49732320	23237225	419.60	196.00	0.73%	0.61%	0.98	0.000	142.5bp	133.0bp	0.27%	1.06%	0.35%	0.00%	0.59%	3.29%	0.56%	0.00%	9999000000	303304430				147bp	241bp	54.0%	0.0%	90.8%	86.4%	95.2%	282.3M	37.3%	97.7%	74924.2Mb	593.1M	54.6%	98.9%	57.3%
tih_rna_sample_00251_23H5VFLT4_s03_1																																	142.5bp	90.9%	269.6M																79.8%	53%	151bp	151bp	27%	341.0M
tih_rna_sample_00251_23H5VFLT4_s03_2																																																			79.2%	54%	151bp	151bp	18%	341.0M
tih_rna_sample_00251_23H5VFLT4_s03_trimmed_1																																																			78.7%	54%	129bp	142bp	18%	296.6M	78.7%	54%	129bp	142bp	18%	296.6M
tih_rna_sample_00251_23H5VFLT4_s03_trimmed_2																																																			78.9%	54%	129bp	142bp	9%	296.6M	78.9%	54%	129bp	142bp	9%	296.6M
tih_rna_sample_00252_23H5VFLT4_s04	Yes	0.00%	592798168	0.01%	0.60%	239121012	0.82%	0.85%	0.16%	0.15%	196636039	99560384	39104175	17913635	376.91	200.00	0.75%	0.62%	0.98	0.000	145.9bp	136.0bp	0.07%	0.60%	0.31%	0.00%	0.15%	1.89%	0.47%	0.00%	9999000000	243401882				157bp	288bp	60.0%	0.0%	92.5%	88.8%	95.8%	283.9M	41.6%	97.6%	75828.8Mb	592.8M	55.2%	98.8%	54.5%
tih_rna_sample_00252_23H5VFLT4_s04_1																																	145.9bp	92.8%	275.0M																79.2%	54%	151bp	151bp	27%	311.5M
tih_rna_sample_00252_23H5VFLT4_s04_2																																																			78.1%	55%	151bp	151bp	18%	311.5M
tih_rna_sample_00252_23H5VFLT4_s04_trimmed_1																																																			78.9%	54%	131bp	142bp	18%	296.4M	78.9%	54%	131bp	142bp	18%	296.4M
tih_rna_sample_00252_23H5VFLT4_s04_trimmed_2																																																			78.5%	55%	131bp	142bp	9%	296.4M	78.5%	55%	131bp	142bp	9%	296.4M
tih_rna_sample_00254_23H5VFLT4_s05	No	0.00%	591796656	0.01%	0.60%	237261161	0.85%	0.88%	0.13%	0.12%	201781162	101703500	30774371	14182887	343.27	143.00	0.70%	0.56%	0.98	0.000	126.9bp	120.0bp	0.43%	0.87%	0.50%	0.00%	0.89%	2.55%	0.73%	0.00%	9999000000	244467564				130bp	206bp	60.4%	0.0%	94.9%	82.6%	93.6%	276.9M	35.4%	97.5%	70103.5Mb	591.8M	58.3%	98.6%	71.0%
tih_rna_sample_00254_23H5VFLT4_s05_1																																	126.9bp	94.4%	279.2M																81.5%	56%	151bp	151bp	27%	376.5M
tih_rna_sample_00254_23H5VFLT4_s05_2																																																			80.7%	57%	151bp	151bp	18%	376.5M
tih_rna_sample_00254_23H5VFLT4_s05_trimmed_1																																																			79.4%	58%	121bp	127bp	18%	295.9M	79.4%	58%	121bp	127bp	18%	295.9M
tih_rna_sample_00254_23H5VFLT4_s05_trimmed_2																																																			79.7%	58%	122bp	127bp	9%	295.9M	79.7%	58%	122bp	127bp	9%	295.9M
tih_rna_sample_00261_23H5VFLT4_s06	No	0.00%	574713108	0.01%	0.62%	220824058	0.77%	0.80%	0.21%	0.20%	169830567	85856218	46814183	22036109	314.39	152.00	0.73%	0.58%	0.97	0.000	142.2bp	133.0bp	0.14%	0.39%	0.24%	0.00%	0.32%	1.30%	0.39%	0.00%	9999000000	250304600				145bp	221bp	62.0%	0.0%	90.4%	84.6%	94.7%	272.2M	41.7%	97.3%	72197.8Mb	574.7M	56.7%	98.7%	58.3%
tih_rna_sample_00261_23H5VFLT4_s06_1																																	142.2bp	90.8%	261.0M																78.8%	55%	151bp	151bp	27%	291.1M
tih_rna_sample_00261_23H5VFLT4_s06_2																																																			78.0%	56%	151bp	151bp	18%	291.1M
tih_rna_sample_00261_23H5VFLT4_s06_trimmed_1																																																			78.9%	56%	129bp	137bp	18%	287.4M	78.9%	56%	129bp	137bp	18%	287.4M
tih_rna_sample_00261_23H5VFLT4_s06_trimmed_2																																																			78.8%	56%	129bp	142bp	9%	287.4M	78.8%	56%	129bp	142bp	9%	287.4M
tih_rna_sample_00272_23H5VFLT4_s09	No	0.00%	593731410	0.01%	0.51%	290165365	0.85%	0.87%	0.14%	0.13%	246864358	124794547	40310544	18408966	477.42	247.00	0.76%	0.64%	0.98	0.000	143.2bp	133.0bp	0.22%	0.47%	0.28%	0.00%	0.48%	1.54%	0.44%	0.00%	9999000000	342193587				166bp	339bp	51.4%	0.0%	92.8%	89.9%	96.2%	285.6M	35.3%	97.7%	75530.5Mb	593.7M	54.6%	99.0%	55.7%
tih_rna_sample_00272_23H5VFLT4_s09_1																																	143.2bp	93.1%	276.5M																80.3%	53%	151bp	151bp	27%	360.8M
tih_rna_sample_00272_23H5VFLT4_s09_2																																																			79.5%	54%	151bp	151bp	18%	360.8M
tih_rna_sample_00272_23H5VFLT4_s09_trimmed_1																																																			78.8%	54%	130bp	142bp	18%	296.9M	78.8%	54%	130bp	142bp	18%	296.9M
tih_rna_sample_00272_23H5VFLT4_s09_trimmed_2																																																			78.8%	54%	130bp	142bp	9%	296.9M	78.8%	54%	130bp	142bp	9%	296.9M
tih_rna_sample_00274_23H5VFLT4_s14	No	0.00%	392539082	0.01%	0.60%	156976267	0.68%	0.70%	0.31%	0.30%	106202235	53492869	47899095	23352836	165.43	82.00	0.66%	0.46%	0.98	0.000	119.8bp	115.0bp	0.10%	0.79%	0.34%	0.00%	0.21%	2.42%	0.49%	0.00%	9999000000	190118129				118bp	150bp	60.5%	0.0%	86.6%	84.3%	94.5%	185.4M	35.3%	97.6%	45108.4Mb	392.5M	53.3%	98.7%	77.0%
tih_rna_sample_00274_23H5VFLT4_s14_1																																	119.8bp	87.0%	170.8M																72.6%	52%	151bp	151bp	27%	198.8M
tih_rna_sample_00274_23H5VFLT4_s14_2																																																			71.2%	53%	151bp	151bp	36%	198.8M
tih_rna_sample_00274_23H5VFLT4_s14_trimmed_1																																																			72.6%	53%	118bp	117bp	18%	196.3M	72.6%	53%	118bp	117bp	18%	196.3M
tih_rna_sample_00274_23H5VFLT4_s14_trimmed_2																																																			71.9%	53%	118bp	122bp	9%	196.3M	71.9%	53%	118bp	122bp	9%	196.3M
tih_rna_sample_00280_23H5VFLT4_s18	No	0.00%	594193126	0.01%	0.44%	329888721	0.89%	0.91%	0.10%	0.09%	291968146	147930096	34031528	14582130	603.70	280.00	0.74%	0.64%	0.98	0.000	156.8bp	144.0bp	0.13%	0.52%	0.44%	0.00%	0.29%	1.62%	0.66%	0.00%	9999000000	448468104				187bp	402bp	44.8%	0.0%	94.0%	86.5%	94.9%	281.8M	31.7%	97.7%	78001.3Mb	594.2M	55.5%	99.0%	47.1%
tih_rna_sample_00280_23H5VFLT4_s18_1																																	156.8bp	94.2%	279.9M																81.6%	54%	151bp	151bp	27%	453.4M
tih_rna_sample_00280_23H5VFLT4_s18_2																																																			81.5%	55%	151bp	151bp	18%	453.4M
tih_rna_sample_00280_23H5VFLT4_s18_trimmed_1																																																			78.5%	55%	134bp	151bp	18%	297.1M	78.5%	55%	134bp	151bp	18%	297.1M
tih_rna_sample_00280_23H5VFLT4_s18_trimmed_2																																																			79.2%	55%	134bp	151bp	9%	297.1M	79.2%	55%	134bp	151bp	9%	297.1M
tih_rna_sample_00377_23H5VFLT4_s23	No	0.00%	593353482	0.01%	0.58%	248622078	0.86%	0.89%	0.12%	0.11%	214077779	108321135	30713686	13694467	405.00	178.00	0.72%	0.59%	0.98	0.000	139.3bp	130.0bp	0.16%	0.59%	0.36%	0.00%	0.38%	1.84%	0.55%	0.00%	9999000000	266811378				151bp	293bp	58.5%	0.0%	94.9%	84.2%	94.3%	279.9M	37.5%	97.6%	74578.3Mb	593.4M	54.6%	98.9%	59.0%
tih_rna_sample_00377_23H5VFLT4_s23_1																																	139.3bp	94.5%	280.5M																82.8%	53%	151bp	151bp	27%	408.3M
tih_rna_sample_00377_23H5VFLT4_s23_2																																																			80.7%	54%	151bp	151bp	27%	408.3M
tih_rna_sample_00377_23H5VFLT4_s23_trimmed_1																																																			80.5%	54%	129bp	137bp	18%	296.7M	80.5%	54%	129bp	137bp	18%	296.7M
tih_rna_sample_00377_23H5VFLT4_s23_trimmed_2																																																			78.8%	54%	129bp	137bp	18%	296.7M	78.8%	54%	129bp	137bp	18%	296.7M
tih_rna_sample_00378_23H5VFLT4_s24	No	0.00%	351290946	0.01%	0.52%	169080437	0.75%	0.76%	0.24%	0.24%	126355247	63660047	40496204	19583850	198.43	98.00	0.67%	0.50%	0.98	0.000	119.7bp	114.0bp	0.22%	2.05%	0.61%	0.00%	0.39%	5.47%	0.81%	0.00%	9999000000	210188740				117bp	164bp	52.2%	0.0%	88.2%	84.8%	94.7%	166.4M	29.6%	97.8%	40083.7Mb	351.3M	50.8%	98.9%	77.4%
tih_rna_sample_00378_23H5VFLT4_s24_1																																	119.7bp	88.1%	154.8M																71.6%	50%	151bp	151bp	27%	177.5M
tih_rna_sample_00378_23H5VFLT4_s24_2																																																			69.9%	51%	151bp	151bp	36%	177.5M
tih_rna_sample_00378_23H5VFLT4_s24_trimmed_1																																																			71.6%	50%	117bp	117bp	18%	175.6M	71.6%	50%	117bp	117bp	18%	175.6M
tih_rna_sample_00378_23H5VFLT4_s24_trimmed_2																																																			70.4%	50%	117bp	117bp	9%	175.6M	70.4%	50%	117bp	117bp	9%	175.6M
tih_rna_sample_00388_23H5VFLT4_s22	No	0.00%	594570998	0.00%	0.46%	322282836	0.88%	0.91%	0.11%	0.09%	285035552	144628332	34457591	14621935	613.08	321.00	0.78%	0.68%	0.98	0.000	165.4bp	152.0bp	0.13%	0.56%	0.36%	0.00%	0.29%	1.93%	0.57%	0.00%	9999000000	439629862				222bp	542bp	46.0%	0.0%	93.8%	90.4%	96.4%	286.6M	33.9%	97.7%	79643.9Mb	594.6M	54.7%	99.1%	40.8%
tih_rna_sample_00388_23H5VFLT4_s22_1																																	165.4bp	94.2%	280.0M																83.1%	54%	151bp	151bp	27%	549.5M
tih_rna_sample_00388_23H5VFLT4_s22_2																																																			82.5%	54%	151bp	151bp	18%	549.5M
tih_rna_sample_00388_23H5VFLT4_s22_trimmed_1																																																			78.9%	54%	137bp	151bp	18%	297.3M	78.9%	54%	137bp	151bp	18%	297.3M
tih_rna_sample_00388_23H5VFLT4_s22_trimmed_2																																																			78.9%	54%	137bp	151bp	9%	297.3M	78.9%	54%	137bp	151bp	9%	297.3M
tih_rna_sample_00394_23H5VFLT4_s25	No	0.00%	386626392	0.01%	0.58%	162730870	0.71%	0.73%	0.27%	0.27%	115428839	58147876	44055905	21374528	191.37	94.00	0.67%	0.49%	0.98	0.000	126.2bp	119.0bp	0.17%	0.53%	0.28%	0.00%	0.40%	1.73%	0.43%	0.00%	9999000000	198626534				124bp	165bp	58.4%	0.0%	87.6%	84.7%	94.7%	183.1M	36.0%	97.6%	45626.0Mb	386.6M	53.8%	98.7%	71.4%
tih_rna_sample_00394_23H5VFLT4_s25_1																																	126.2bp	87.8%	169.7M																73.5%	53%	151bp	151bp	27%	195.8M
tih_rna_sample_00394_23H5VFLT4_s25_2																																																			72.3%	53%	151bp	151bp	36%	195.8M
tih_rna_sample_00394_23H5VFLT4_s25_trimmed_1																																																			73.5%	53%	121bp	122bp	18%	193.3M	73.5%	53%	121bp	122bp	18%	193.3M
tih_rna_sample_00394_23H5VFLT4_s25_trimmed_2																																																			73.0%	53%	121bp	122bp	9%	193.3M	73.0%	53%	121bp	122bp	9%	193.3M
tih_rna_sample_00396_23H5VFLT4_s26	No	0.00%	594209144	0.01%	0.41%	348155074	0.87%	0.89%	0.12%	0.11%	303567686	153853771	41360872	18122082	630.19	334.00	0.75%	0.66%	0.98	0.000	156.8bp	145.0bp	0.31%	1.00%	0.43%	0.00%	0.69%	3.10%	0.64%	0.00%	9999000000	514111361				184bp	403bp	41.6%	0.0%	93.0%	89.0%	95.8%	284.5M	29.1%	97.7%	78101.4Mb	594.2M	54.1%	99.0%	46.7%
tih_rna_sample_00396_23H5VFLT4_s26_1																																	156.8bp	93.2%	277.0M																79.8%	53%	151bp	151bp	27%	423.6M
tih_rna_sample_00396_23H5VFLT4_s26_2																																																			79.4%	54%	151bp	151bp	18%	423.6M
tih_rna_sample_00396_23H5VFLT4_s26_trimmed_1																																																			77.2%	53%	135bp	151bp	18%	297.1M	77.2%	53%	135bp	151bp	18%	297.1M
tih_rna_sample_00396_23H5VFLT4_s26_trimmed_2																																																			77.4%	54%	135bp	151bp	9%	297.1M	77.4%	54%	135bp	151bp	9%	297.1M
tih_rna_sample_00400_23H5VFLT4_s27	Yes	0.00%	593301118	0.01%	0.50%	298722857	0.85%	0.88%	0.13%	0.12%	255213606	128720350	39715449	18364008	464.53	244.00	0.76%	0.64%	0.98	0.000	132.2bp	125.0bp	0.20%	0.70%	0.38%	0.00%	0.42%	2.10%	0.56%	0.00%	9999000000	366977446				138bp	231bp	50.0%	0.0%	93.4%	86.1%	94.8%	281.1M	31.1%	97.7%	72471.5Mb	593.3M	54.1%	98.9%	64.2%
tih_rna_sample_00400_23H5VFLT4_s27_1																																	132.2bp	93.4%	277.0M																80.6%	53%	151bp	151bp	27%	415.5M
tih_rna_sample_00400_23H5VFLT4_s27_2																																																			79.9%	54%	151bp	151bp	18%	415.5M
tih_rna_sample_00400_23H5VFLT4_s27_trimmed_1																																																			78.0%	53%	125bp	132bp	18%	296.7M	78.0%	53%	125bp	132bp	18%	296.7M
tih_rna_sample_00400_23H5VFLT4_s27_trimmed_2																																																			77.9%	54%	125bp	132bp	9%	296.7M	77.9%	54%	125bp	132bp	9%	296.7M
tih_rna_sample_00402_23H5VFLT4_s28	Yes	0.00%	594535990	0.01%	0.44%	330775856	0.85%	0.87%	0.14%	0.13%	281506898	142295299	45981833	21059122	543.11	289.00	0.77%	0.66%	0.98	0.000	142.4bp	133.0bp	0.20%	1.12%	0.33%	0.00%	0.44%	3.56%	0.52%	0.00%	9999000000	492857734				154bp	286bp	44.6%	0.0%	91.9%	87.9%	95.2%	283.1M	29.0%	97.5%	75165.2Mb	594.5M	53.1%	99.1%	56.7%
tih_rna_sample_00402_23H5VFLT4_s28_1																																	142.4bp	92.5%	274.9M																79.2%	52%	151bp	151bp	27%	395.4M
tih_rna_sample_00402_23H5VFLT4_s28_2																																																			78.5%	53%	151bp	151bp	18%	395.4M
tih_rna_sample_00402_23H5VFLT4_s28_trimmed_1																																																			77.0%	52%	130bp	142bp	18%	297.3M	77.0%	52%	130bp	142bp	18%	297.3M
tih_rna_sample_00402_23H5VFLT4_s28_trimmed_2																																																			76.9%	53%	130bp	142bp	9%	297.3M	76.9%	53%	130bp	142bp	9%	297.3M
tih_rna_sample_00403_23H5VFLT4_s29	No	0.00%	593754178	0.01%	0.54%	271888036	0.81%	0.84%	0.17%	0.16%	221366955	111796841	46885487	21985248	396.70	186.00	0.74%	0.61%	0.98	0.000	133.5bp	125.0bp	0.19%	0.63%	0.36%	0.00%	0.41%	1.97%	0.52%	0.00%	9999000000	303710901				135bp	209bp	54.5%	0.0%	91.2%	89.2%	95.8%	284.5M	34.9%	97.7%	72661.2Mb	593.8M	54.0%	99.0%	64.2%
tih_rna_sample_00403_23H5VFLT4_s29_1																																	133.5bp	91.5%	271.7M																78.0%	53%	151bp	151bp	27%	323.0M
tih_rna_sample_00403_23H5VFLT4_s29_2																																																			77.4%	53%	151bp	151bp	18%	323.0M
tih_rna_sample_00403_23H5VFLT4_s29_trimmed_1																																																			77.5%	53%	125bp	132bp	18%	296.9M	77.5%	53%	125bp	132bp	18%	296.9M
tih_rna_sample_00403_23H5VFLT4_s29_trimmed_2																																																			77.4%	54%	125bp	132bp	9%	296.9M	77.4%	54%	125bp	132bp	9%	296.9M
tih_rna_sample_00407_23H5VFLT4_s33	No	0.00%	568787934	0.01%	0.71%	163235783	0.76%	0.79%	0.21%	0.21%	124343412	62917849	34655631	16246801	230.07	111.00	0.70%	0.52%	0.98	0.000	143.0bp	132.0bp	0.12%	0.52%	0.36%	0.00%	0.26%	1.64%	0.54%	0.00%	9999000000	159567054				152bp	262bp	71.8%	0.0%	92.5%	86.2%	95.0%	270.2M	50.3%	97.5%	71694.5Mb	568.8M	56.9%	98.7%	57.0%
tih_rna_sample_00407_23H5VFLT4_s33_1																																	143.0bp	92.3%	262.5M																83.3%	55%	151bp	151bp	27%	288.2M
tih_rna_sample_00407_23H5VFLT4_s33_2																																																			82.3%	56%	151bp	151bp	18%	288.2M
tih_rna_sample_00407_23H5VFLT4_s33_trimmed_1																																																			83.4%	56%	129bp	142bp	18%	284.4M	83.4%	56%	129bp	142bp	18%	284.4M
tih_rna_sample_00407_23H5VFLT4_s33_trimmed_2																																																			83.3%	57%	129bp	142bp	9%	284.4M	83.3%	57%	129bp	142bp	9%	284.4M
tih_rna_sample_00410_23H5VFLT4_s34	No	0.00%	551546748	0.01%	0.69%	172422442	0.71%	0.74%	0.26%	0.26%	122934710	62052737	45678563	21953944	209.80	101.00	0.67%	0.50%	0.98	0.000	131.8bp	124.0bp	0.05%	0.76%	0.40%	0.00%	0.10%	2.30%	0.60%	0.00%	9999000000	177363137				134bp	208bp	69.2%	0.0%	90.3%	86.3%	95.1%	262.2M	46.4%	97.6%	67127.2Mb	551.5M	53.2%	98.6%	66.2%
tih_rna_sample_00410_23H5VFLT4_s34_1																																	131.8bp	90.6%	249.8M																79.7%	52%	151bp	151bp	27%	279.8M
tih_rna_sample_00410_23H5VFLT4_s34_2																																																			78.9%	53%	151bp	151bp	18%	279.8M
tih_rna_sample_00410_23H5VFLT4_s34_trimmed_1																																																			79.8%	53%	125bp	132bp	18%	275.8M	79.8%	53%	125bp	132bp	18%	275.8M
tih_rna_sample_00410_23H5VFLT4_s34_trimmed_2																																																			79.7%	53%	125bp	132bp	9%	275.8M	79.7%	53%	125bp	132bp	9%	275.8M
tih_rna_sample_00414_23H5VFLT4_s40	Yes	0.00%	593641024	0.01%	0.45%	324684509	0.86%	0.88%	0.13%	0.12%	277866029	140593203	42658922	19196927	542.87	265.00	0.76%	0.65%	0.98	0.000	148.1bp	137.0bp	0.10%	0.76%	0.38%	0.00%	0.21%	2.35%	0.58%	0.00%	9999000000	428904482				157bp	276bp	45.6%	0.0%	92.2%	87.0%	95.0%	281.9M	31.4%	97.6%	75683.9Mb	593.6M	56.3%	98.9%	54.2%
tih_rna_sample_00414_23H5VFLT4_s40_1																																	148.1bp	92.5%	274.5M																79.7%	55%	151bp	151bp	27%	364.3M
tih_rna_sample_00414_23H5VFLT4_s40_2																																																			79.4%	56%	151bp	151bp	18%	364.3M
tih_rna_sample_00414_23H5VFLT4_s40_trimmed_1																																																			78.2%	56%	131bp	142bp	18%	296.8M	78.2%	56%	131bp	142bp	18%	296.8M
tih_rna_sample_00414_23H5VFLT4_s40_trimmed_2																																																			78.7%	56%	131bp	142bp	9%	296.8M	78.7%	56%	131bp	142bp	9%	296.8M
tih_rna_sample_00419_23H5VFLT4_s44	Yes	0.00%	593426968	0.00%	0.44%	330847130	0.88%	0.90%	0.11%	0.10%	290343407	146914686	37627452	16566030	577.32	273.00	0.73%	0.63%	0.98	0.000	150.2bp	138.0bp	0.23%	1.09%	0.49%	0.00%	0.50%	3.28%	0.72%	0.00%	9999000000	446330973				167bp	347bp	44.5%	0.0%	93.6%	88.7%	95.8%	284.2M	29.8%	97.7%	75996.6Mb	593.4M	54.7%	98.9%	52.6%
tih_rna_sample_00419_23H5VFLT4_s44_1																																	150.2bp	93.9%	278.7M																80.9%	54%	151bp	151bp	27%	434.5M
tih_rna_sample_00419_23H5VFLT4_s44_2																																																			80.4%	54%	151bp	151bp	18%	434.5M
tih_rna_sample_00419_23H5VFLT4_s44_trimmed_1																																																			78.0%	54%	131bp	147bp	18%	296.7M	78.0%	54%	131bp	147bp	18%	296.7M
tih_rna_sample_00419_23H5VFLT4_s44_trimmed_2																																																			78.4%	54%	131bp	147bp	9%	296.7M	78.4%	54%	131bp	147bp	9%	296.7M
tih_rna_sample_00420_23H5VFLT4_s45	No	0.00%	389910420	0.01%	0.76%	93098276	0.62%	0.65%	0.35%	0.35%	57320191	28992777	32567328	15723102	99.71	48.00	0.59%	0.31%	0.98	0.000	137.4bp	128.0bp	0.11%	0.28%	0.20%	0.00%	0.23%	0.92%	0.32%	0.00%	9999000000	108401346				139bp	208bp	76.8%	0.0%	89.3%	84.9%	94.6%	184.4M	53.4%	97.5%	48206.7Mb	389.9M	55.7%	98.3%	61.5%
tih_rna_sample_00420_23H5VFLT4_s45_1																																	137.4bp	89.9%	175.2M																82.2%	55%	151bp	151bp	27%	198.4M
tih_rna_sample_00420_23H5VFLT4_s45_2																																																			80.4%	55%	151bp	151bp	18%	198.4M
tih_rna_sample_00420_23H5VFLT4_s45_trimmed_1																																																			82.2%	55%	127bp	137bp	18%	195.0M	82.2%	55%	127bp	137bp	18%	195.0M
tih_rna_sample_00420_23H5VFLT4_s45_trimmed_2																																																			81.3%	55%	127bp	137bp	9%	195.0M	81.3%	55%	127bp	137bp	9%	195.0M
tih_rna_sample_00422_23H5VFLT4_s47	No	0.00%	169264240	0.01%	0.73%	45174579	0.50%	0.52%	0.46%	0.48%	22455775	11282989	20740848	10235737	30.65	12.00	0.29%	0.06%	0.98	0.000	109.2bp	105.0bp	0.46%	0.94%	0.35%	0.00%	0.94%	2.84%	0.52%	0.00%	9999000000	61455637				107bp	129bp	74.2%	0.0%	85.9%	78.3%	92.6%	78.4M	40.1%	97.5%	17953.5Mb	169.3M	54.5%	97.0%	84.7%
tih_rna_sample_00422_23H5VFLT4_s47_1																																	109.2bp	85.4%	72.3M																76.2%	53%	151bp	151bp	27%	87.2M
tih_rna_sample_00422_23H5VFLT4_s47_2																																																			74.5%	55%	151bp	151bp	45%	87.2M
tih_rna_sample_00422_23H5VFLT4_s47_trimmed_1																																																			75.8%	54%	109bp	107bp	18%	84.6M	75.8%	54%	109bp	107bp	18%	84.6M
tih_rna_sample_00422_23H5VFLT4_s47_trimmed_2																																																			75.1%	54%	109bp	107bp	9%	84.6M	75.1%	54%	109bp	107bp	9%	84.6M
tih_rna_sample_00425_23H5VFLT4_s46	No	0.00%	464587216	0.01%	0.71%	133728172	0.62%	0.65%	0.34%	0.35%	83527122	42062134	45710358	22307382	134.23	62.00	0.63%	0.39%	0.98	0.000	124.9bp	118.0bp	0.07%	0.53%	0.21%	0.00%	0.17%	1.79%	0.36%	0.00%	9999000000	146514862				124bp	165bp	71.9%	0.0%	88.3%	83.2%	94.2%	218.9M	45.3%	97.4%	54356.8Mb	464.6M	56.7%	98.2%	72.4%
tih_rna_sample_00425_23H5VFLT4_s46_1																																	124.9bp	88.3%	205.2M																80.1%	55%	151bp	151bp	27%	236.4M
tih_rna_sample_00425_23H5VFLT4_s46_2																																																			78.8%	56%	151bp	151bp	27%	236.4M
tih_rna_sample_00425_23H5VFLT4_s46_trimmed_1																																																			80.1%	56%	120bp	122bp	18%	232.3M	80.1%	56%	120bp	122bp	18%	232.3M
tih_rna_sample_00425_23H5VFLT4_s46_trimmed_2																																																			79.7%	56%	120bp	122bp	9%	232.3M	79.7%	56%	120bp	122bp	9%	232.3M
tih_rna_sample_00426_23H5VFLT4_s48	No	0.00%	574610528	0.01%	0.65%	200940478	0.79%	0.82%	0.18%	0.18%	158783184	80343547	37116244	17142577	296.20	121.00	0.68%	0.53%	0.98	0.000	143.0bp	132.0bp	0.22%	0.91%	0.27%	0.00%	0.46%	2.78%	0.44%	0.00%	9999000000	193132951				148bp	232bp	65.6%	0.0%	91.5%	77.1%	92.5%	265.8M	44.9%	97.4%	72397.7Mb	574.6M	58.4%	98.3%	56.5%
tih_rna_sample_00426_23H5VFLT4_s48_1																																	143.0bp	91.5%	262.8M																82.1%	57%	151bp	151bp	27%	292.3M
tih_rna_sample_00426_23H5VFLT4_s48_2																																																			81.0%	57%	151bp	151bp	18%	292.3M
tih_rna_sample_00426_23H5VFLT4_s48_trimmed_1																																																			82.2%	58%	129bp	142bp	18%	287.3M	82.2%	58%	129bp	142bp	18%	287.3M
tih_rna_sample_00426_23H5VFLT4_s48_trimmed_2																																																			82.2%	58%	129bp	142bp	9%	287.3M	82.2%	58%	129bp	142bp	9%	287.3M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
GM24385_0001_RNA_0001_23H5VFLT4_s08	657.8M	0.0M	0.0M	85.0M	5.6M	539.7M	270.0M	269.7M	269.9M	269.8M	325.4M	214.2M	538.0M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s16	657.3M	0.0M	0.0M	78.5M	5.6M	547.0M	273.7M	273.3M	273.5M	273.5M	326.5M	220.5M	545.2M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s24	524.2M	0.0M	0.0M	61.3M	4.6M	437.8M	219.0M	218.7M	218.9M	218.9M	264.6M	173.1M	436.4M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s32	528.8M	0.0M	0.0M	67.9M	4.6M	434.3M	217.3M	217.0M	217.2M	217.1M	266.8M	167.5M	433.1M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s40	571.9M	0.0M	0.0M	63.8M	4.7M	482.0M	241.1M	240.9M	241.0M	241.0M	296.3M	185.7M	480.7M	0.0M
GM24385_0001_RNA_0001_23H5VFLT4_s48	488.0M	0.0M	0.0M	60.3M	4.2M	403.5M	201.9M	201.6M	201.8M	201.7M	246.4M	157.1M	402.4M	0.0M
HD789_0002_RNA_0008_23H5VFLT4_s19	637.9M	0.0M	0.0M	42.3M	2.5M	576.0M	288.1M	287.8M	288.0M	288.0M	280.5M	295.5M	574.3M	0.0M
NTC_0001_0001_23H5VFLT4_s15	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
V4_0001_RNA_0001_23H5VFLT4_s13	641.4M	0.0M	0.0M	45.4M	3.1M	574.5M	287.4M	287.1M	287.3M	287.2M	287.6M	286.9M	572.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s01	657.0M	0.0M	0.0M	66.2M	3.9M	563.4M	281.8M	281.6M	281.7M	281.7M	303.6M	259.8M	561.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s02	656.3M	0.0M	0.0M	65.4M	4.1M	563.7M	281.9M	281.7M	281.8M	281.8M	311.0M	252.7M	561.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s03	662.7M	0.0M	0.0M	71.8M	4.4M	561.8M	281.0M	280.8M	280.9M	280.9M	314.2M	247.6M	559.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s04	664.2M	0.0M	0.0M	74.5M	4.9M	559.5M	279.9M	279.6M	279.8M	279.7M	320.8M	238.7M	557.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s05	674.6M	0.0M	0.0M	85.6M	5.4M	555.9M	278.0M	277.8M	277.9M	277.9M	327.4M	228.5M	554.1M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s06	669.6M	0.0M	0.0M	80.6M	5.3M	557.2M	278.7M	278.5M	278.6M	278.6M	329.5M	227.7M	555.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s07	597.6M	0.0M	0.0M	87.6M	5.6M	476.9M	238.6M	238.3M	238.4M	238.4M	292.2M	184.7M	475.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s09	646.6M	0.0M	0.0M	54.4M	3.5M	568.2M	284.3M	284.0M	284.1M	284.1M	299.1M	269.1M	566.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s10	649.7M	0.0M	0.0M	58.3M	3.8M	566.1M	283.2M	282.9M	283.1M	283.1M	304.0M	262.2M	564.3M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s11	626.6M	0.0M	0.0M	60.7M	4.1M	540.1M	270.2M	269.9M	270.1M	270.0M	297.2M	242.9M	538.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s12	663.2M	0.0M	0.0M	73.2M	4.9M	560.0M	280.1M	279.8M	280.0M	280.0M	321.2M	238.8M	558.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s13	661.4M	0.0M	0.0M	70.6M	5.1M	561.2M	280.8M	280.5M	280.6M	280.6M	322.6M	238.7M	559.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s14	664.7M	0.0M	0.0M	74.1M	5.3M	560.3M	280.3M	280.0M	280.2M	280.1M	326.4M	233.9M	558.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s15	626.6M	0.0M	0.0M	69.9M	5.0M	527.9M	264.1M	263.8M	263.9M	263.9M	308.8M	219.1M	526.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s17	643.7M	0.0M	0.0M	52.0M	3.4M	568.6M	284.4M	284.2M	284.3M	284.3M	298.4M	270.1M	566.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s18	650.9M	0.0M	0.0M	60.9M	3.9M	564.1M	282.2M	281.9M	282.1M	282.1M	304.7M	259.4M	562.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s19	657.1M	0.0M	0.0M	65.5M	4.5M	564.1M	282.2M	281.9M	282.1M	282.0M	312.5M	251.6M	562.3M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s20	666.0M	0.0M	0.0M	76.0M	5.0M	559.5M	279.9M	279.6M	279.8M	279.7M	319.0M	240.5M	557.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s21	666.1M	0.0M	0.0M	80.1M	5.2M	554.7M	277.5M	277.2M	277.4M	277.3M	322.2M	232.5M	552.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s22	578.2M	0.0M	0.0M	65.6M	4.7M	485.8M	243.1M	242.8M	242.9M	242.9M	284.6M	201.2M	484.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s23	652.1M	0.0M	0.0M	77.5M	5.4M	543.4M	271.8M	271.5M	271.7M	271.7M	320.6M	222.8M	541.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s25	646.5M	0.0M	0.0M	55.9M	3.5M	566.3M	283.2M	283.0M	283.1M	283.1M	300.6M	265.6M	564.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s26	647.4M	0.0M	0.0M	60.0M	4.0M	561.8M	281.0M	280.8M	280.9M	280.9M	303.5M	258.3M	559.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s27	653.1M	0.0M	0.0M	63.8M	4.3M	562.3M	281.3M	281.0M	281.2M	281.1M	311.1M	251.2M	560.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s28	531.2M	0.0M	0.0M	59.4M	3.9M	447.9M	224.1M	223.9M	224.0M	224.0M	256.4M	191.6M	446.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s29	654.5M	0.0M	0.0M	67.0M	4.9M	559.2M	279.7M	279.4M	279.6M	279.6M	326.3M	232.9M	557.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s30	546.3M	0.0M	0.0M	63.2M	4.3M	457.8M	229.0M	228.8M	228.9M	228.9M	270.4M	187.4M	456.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s31	663.5M	0.0M	0.0M	75.6M	5.2M	557.5M	278.9M	278.6M	278.8M	278.8M	328.1M	229.4M	555.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s33	644.1M	0.0M	0.0M	53.9M	3.4M	566.3M	283.3M	283.0M	283.2M	283.2M	302.5M	263.8M	564.7M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s34	647.4M	0.0M	0.0M	60.0M	4.0M	561.5M	280.9M	280.6M	280.8M	280.7M	305.1M	256.4M	559.6M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s35	520.0M	0.0M	0.0M	55.1M	3.6M	442.2M	221.2M	221.0M	221.1M	221.1M	246.8M	195.4M	440.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s36	623.6M	0.0M	0.0M	64.0M	4.6M	532.7M	266.5M	266.2M	266.4M	266.3M	306.0M	226.7M	531.0M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s37	612.0M	0.0M	0.0M	64.5M	4.7M	520.5M	260.4M	260.1M	260.3M	260.2M	304.8M	215.7M	518.9M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s38	602.7M	0.0M	0.0M	72.3M	5.1M	501.4M	250.8M	250.6M	250.7M	250.7M	298.8M	202.6M	500.0M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s39	559.5M	0.0M	0.0M	62.8M	4.6M	470.9M	235.6M	235.3M	235.4M	235.4M	279.4M	191.4M	469.5M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s41	646.0M	0.0M	0.0M	56.3M	3.5M	564.7M	282.5M	282.2M	282.4M	282.4M	303.4M	261.3M	563.2M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s42	648.8M	0.0M	0.0M	59.6M	4.0M	563.2M	281.7M	281.4M	281.6M	281.6M	306.7M	256.5M	561.3M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s43	653.4M	0.0M	0.0M	64.7M	4.3M	561.0M	280.7M	280.4M	280.5M	280.5M	317.2M	243.8M	559.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s44	610.4M	0.0M	0.0M	67.5M	4.6M	515.3M	257.8M	257.5M	257.7M	257.6M	298.9M	216.4M	513.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s45	633.0M	0.0M	0.0M	73.2M	5.1M	530.2M	265.3M	265.0M	265.1M	265.1M	315.4M	214.9M	528.8M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s46	534.0M	0.0M	0.0M	62.8M	4.4M	445.7M	223.0M	222.7M	222.9M	222.8M	265.2M	180.5M	444.4M	0.0M
V4_0001_RNA_0005_23H5VFLT4_s47	666.1M	0.0M	0.0M	81.0M	5.8M	552.6M	276.5M	276.2M	276.3M	276.3M	333.5M	219.1M	550.9M	0.0M
tih_rna_sample_00087_23H5VFLT4_s17	643.7M	0.0M	0.0M	46.3M	3.1M	574.9M	287.6M	287.3M	287.4M	287.4M	319.7M	255.1M	572.8M	0.0M
tih_rna_sample_00088_23H5VFLT4_s02	648.2M	0.0M	0.0M	52.8M	4.0M	573.2M	286.8M	286.4M	286.7M	286.5M	305.3M	267.9M	571.1M	0.0M
tih_rna_sample_00089_23H5VFLT4_s39	645.1M	0.0M	0.0M	48.8M	3.0M	574.8M	287.6M	287.2M	287.4M	287.4M	300.2M	274.6M	572.8M	0.0M
tih_rna_sample_00090_23H5VFLT4_s32	687.8M	0.0M	0.0M	92.1M	6.5M	558.9M	279.7M	279.2M	279.5M	279.4M	331.9M	227.0M	556.6M	0.0M
tih_rna_sample_00096_23H5VFLT4_s11	641.1M	0.0M	0.0M	44.4M	3.0M	576.6M	288.4M	288.1M	288.3M	288.3M	325.8M	250.8M	574.6M	0.0M
tih_rna_sample_00097_23H5VFLT4_s12	653.4M	0.0M	0.0M	56.1M	3.0M	573.2M	286.8M	286.5M	286.6M	286.6M	302.3M	270.9M	571.1M	0.0M
tih_rna_sample_00104_23H5VFLT4_s20	494.7M	0.0M	0.0M	77.7M	5.7M	389.1M	194.8M	194.3M	194.6M	194.5M	260.8M	128.3M	387.4M	0.0M
tih_rna_sample_00105_23H5VFLT4_s21	135.8M	0.0M	0.0M	24.7M	1.7M	102.5M	51.3M	51.2M	51.3M	51.2M	78.3M	24.2M	102.0M	0.0M
tih_rna_sample_00111_23H5VFLT4_s30	384.1M	0.0M	0.0M	45.0M	4.1M	320.9M	160.6M	160.3M	160.5M	160.5M	217.0M	103.9M	319.5M	0.0M
tih_rna_sample_00115_23H5VFLT4_s35	565.0M	0.0M	0.0M	64.6M	4.4M	476.0M	238.2M	237.7M	238.1M	237.9M	304.5M	171.5M	473.9M	0.0M
tih_rna_sample_00116_23H5VFLT4_s36	652.3M	0.0M	0.0M	56.2M	4.1M	571.7M	286.0M	285.7M	285.9M	285.8M	330.8M	240.9M	569.4M	0.0M
tih_rna_sample_00117_23H5VFLT4_s37	458.7M	0.0M	0.0M	42.2M	3.1M	398.4M	199.4M	199.1M	199.2M	199.2M	237.0M	161.5M	397.1M	0.0M
tih_rna_sample_00118_23H5VFLT4_s38	646.5M	0.0M	0.0M	50.4M	3.1M	574.3M	287.3M	287.0M	287.1M	287.1M	305.0M	269.3M	572.3M	0.0M
tih_rna_sample_00121_23H5VFLT4_s41	662.1M	0.0M	0.0M	66.2M	5.1M	568.6M	284.6M	284.0M	284.3M	284.2M	341.2M	227.4M	566.4M	0.0M
tih_rna_sample_00122_23H5VFLT4_s42	484.7M	0.0M	0.0M	57.9M	3.3M	405.2M	202.8M	202.4M	202.6M	202.6M	269.7M	135.5M	403.6M	0.0M
tih_rna_sample_00124_23H5VFLT4_s31	640.0M	0.0M	0.0M	43.2M	3.7M	576.1M	288.2M	287.9M	288.1M	288.0M	308.9M	267.2M	573.8M	0.0M
tih_rna_sample_00127_23H5VFLT4_s08	508.3M	0.0M	0.0M	48.9M	3.2M	440.1M	220.1M	220.0M	220.1M	220.0M	266.6M	173.5M	438.0M	0.0M
tih_rna_sample_00163_23H5VFLT4_s43	638.7M	0.0M	0.0M	42.3M	3.1M	576.0M	288.2M	287.8M	288.0M	288.0M	317.7M	258.2M	574.2M	0.0M
tih_rna_sample_00218_23H5VFLT4_s10	638.2M	0.0M	0.0M	40.7M	2.9M	578.3M	289.3M	289.0M	289.2M	289.1M	295.0M	283.3M	576.2M	0.0M
tih_rna_sample_00220_23H5VFLT4_s16	646.7M	0.0M	0.0M	49.8M	3.7M	575.6M	288.0M	287.6M	287.9M	287.8M	325.3M	250.3M	573.4M	0.0M
tih_rna_sample_00235_23H5VFLT4_s07	641.7M	0.0M	0.0M	44.5M	3.4M	577.0M	288.6M	288.4M	288.5M	288.5M	303.6M	273.3M	574.7M	0.0M
tih_rna_sample_00248_23H5VFLT4_s01	651.5M	0.0M	0.0M	54.6M	3.4M	573.2M	286.7M	286.4M	286.6M	286.6M	329.7M	243.4M	570.8M	0.0M
tih_rna_sample_00251_23H5VFLT4_s03	657.6M	0.0M	0.0M	62.0M	3.5M	570.1M	285.2M	284.8M	285.0M	285.0M	334.8M	235.3M	568.2M	0.0M
tih_rna_sample_00252_23H5VFLT4_s04	643.7M	0.0M	0.0M	48.1M	3.4M	574.0M	287.1M	286.9M	287.0M	287.0M	323.2M	250.8M	571.8M	0.0M
tih_rna_sample_00254_23H5VFLT4_s05	676.0M	0.0M	0.0M	80.8M	4.7M	561.1M	280.7M	280.4M	280.6M	280.5M	321.7M	239.4M	558.6M	0.0M
tih_rna_sample_00261_23H5VFLT4_s06	648.1M	0.0M	0.0M	70.8M	4.2M	550.0M	275.2M	274.9M	275.0M	275.0M	333.9M	216.2M	548.1M	0.0M
tih_rna_sample_00272_23H5VFLT4_s09	639.6M	0.0M	0.0M	43.3M	3.0M	577.1M	288.7M	288.4M	288.6M	288.5M	304.8M	272.3M	575.0M	0.0M
tih_rna_sample_00274_23H5VFLT4_s14	444.5M	0.0M	0.0M	49.1M	2.9M	376.6M	188.4M	188.2M	188.3M	188.3M	247.7M	128.9M	374.7M	0.0M
tih_rna_sample_00280_23H5VFLT4_s18	655.4M	0.0M	0.0M	58.7M	3.9M	569.1M	284.7M	284.4M	284.6M	284.6M	295.6M	273.5M	567.2M	0.0M
tih_rna_sample_00377_23H5VFLT4_s23	672.1M	0.0M	0.0M	74.4M	3.8M	568.6M	284.2M	284.5M	284.4M	284.3M	309.5M	259.1M	565.6M	0.0M
tih_rna_sample_00378_23H5VFLT4_s24	396.1M	0.0M	0.0M	42.4M	2.2M	337.7M	168.9M	168.8M	168.9M	168.8M	206.4M	131.3M	336.0M	0.0M
tih_rna_sample_00388_23H5VFLT4_s22	638.1M	0.0M	0.0M	41.1M	2.8M	578.7M	289.5M	289.2M	289.4M	289.3M	290.9M	287.8M	576.7M	0.0M
tih_rna_sample_00394_23H5VFLT4_s25	435.5M	0.0M	0.0M	46.9M	3.2M	370.2M	185.3M	184.9M	185.1M	185.1M	239.8M	130.4M	368.9M	0.0M
tih_rna_sample_00396_23H5VFLT4_s26	643.0M	0.0M	0.0M	46.5M	3.2M	574.1M	287.2M	286.8M	287.0M	287.0M	302.5M	271.6M	572.2M	0.0M
tih_rna_sample_00400_23H5VFLT4_s27	657.9M	0.0M	0.0M	61.9M	3.8M	568.2M	284.3M	283.9M	284.1M	284.1M	325.0M	243.2M	566.2M	0.0M
tih_rna_sample_00402_23H5VFLT4_s28	648.7M	0.0M	0.0M	51.4M	3.3M	572.6M	286.5M	286.1M	286.3M	286.3M	318.1M	254.4M	570.4M	0.0M
tih_rna_sample_00403_23H5VFLT4_s29	643.4M	0.0M	0.0M	46.5M	3.6M	576.1M	288.2M	287.9M	288.1M	288.0M	345.8M	230.3M	573.7M	0.0M
tih_rna_sample_00407_23H5VFLT4_s33	631.1M	0.0M	0.0M	60.0M	4.2M	545.5M	272.9M	272.6M	272.8M	272.7M	314.6M	230.9M	543.8M	0.0M
tih_rna_sample_00410_23H5VFLT4_s34	612.0M	0.0M	0.0M	57.6M	3.8M	530.3M	265.4M	265.0M	265.2M	265.1M	313.9M	216.5M	528.3M	0.0M
tih_rna_sample_00414_23H5VFLT4_s40	652.2M	0.0M	0.0M	56.1M	4.2M	569.4M	284.9M	284.5M	284.7M	284.7M	326.9M	242.5M	567.4M	0.0M
tih_rna_sample_00419_23H5VFLT4_s44	644.9M	0.0M	0.0M	49.2M	2.9M	573.5M	286.9M	286.6M	286.8M	286.8M	308.7M	264.8M	571.7M	0.0M
tih_rna_sample_00420_23H5VFLT4_s45	436.9M	0.0M	0.0M	45.4M	3.2M	372.1M	186.2M	185.9M	186.1M	186.1M	230.3M	141.8M	371.0M	0.0M
tih_rna_sample_00422_23H5VFLT4_s47	201.8M	0.0M	0.0M	31.6M	2.0M	158.7M	79.4M	79.2M	79.3M	79.3M	109.5M	49.2M	158.0M	0.0M
tih_rna_sample_00425_23H5VFLT4_s46	529.4M	0.0M	0.0M	62.7M	4.5M	442.2M	221.3M	220.9M	221.1M	221.1M	288.7M	153.4M	440.7M	0.0M
tih_rna_sample_00426_23H5VFLT4_s48	693.1M	0.0M	0.0M	116.2M	5.0M	536.2M	268.3M	267.9M	268.1M	268.1M	320.5M	215.7M	534.6M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	237288855	0.2122%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	4010	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	3520	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	1506	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	1387	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	180	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	174	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	171	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	142	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	147	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	188	0.0000%
GCCCCCCCGGCAGCAGC	2	83	0.0000%
GCTGCTGCCGGGGGGGC	2	79	0.0000%
GGCCCCCCCGGCAGCAGC	2	75	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATAGGCTATCTAGTAT	1	507305	0.0005%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGCCATAATCTGGTGG	1	277644	0.0002%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGCCATAATCTGGGGG	1	245093	0.0002%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTGATTGATCTGGTGT	1	926383	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGTCCAAATCTGGGGG	1	799228	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGTCCAAATCTGGGGT	1	320709	0.0003%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	64743248	0.1256%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	1990	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	1759	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	750	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	180	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	174	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	171	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	142	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	147	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	188	0.0000%
GCCCCCCCGGCAGCAGC	2	83	0.0000%
GCTGCTGCCGGGGGGGC	2	79	0.0000%
GGCCCCCCCGGCAGCAGC	2	75	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	1	254	0.0000%
CTTCGCGCCCTCTCTCTCTCTCTCTCCCCC	1	222	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	1	162	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	1	155	0.0000%
TTCCCCACCGGGCCTTCCCGT	1	124	0.0000%
GTGCTGCTGCCGGGGGGGC	1	82	0.0000%
CTTCGCGCCCTCTCTCTCTCTCTCTCCCC	1	79	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`v3.0.2-g3e50177`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run 'https://gitlab.natera.com/rd-platform/bioinformatics/nextflow/rnafusion.git' -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp003/B23H5VFLT4/nfcore_rnafusion__3e501777--20260519-101300' -r 3e501777 -profile docker,eks,std_run -name dev_rna_exp0001_exp003_3e501777 --rundir 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/' --bclconvert_samplesheet 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/bclconvert_samplesheet.csv' --flowcell_id 20251217_LH00166_0224_B23H5VFLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp003/B23H5VFLT4/nfcore_rnafusion__3e501777--20260519-101300'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0001_exp003_3e501777
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /tmp/home/.nextflow/assets/rd-platform/bioinformatics/nextflow/rnafusion
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001_exp003/B23H5VFLT4/nfcore_rnafusion__3e501777--20260519-101300
rundir: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/
flowcell_id: 20251217_LH00166_0224_B23H5VFLT4
strand: reverse
bclconvert_samplesheet: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20251217_LH00166_0224_B23H5VFLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks