Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 641054
total bases: 96799154
Q20 bases: 82935654(85.6781%)
Q30 bases: 61809351(63.8532%)

Read2 before filtering:
total reads: 641054
total bases: 96799154
Q20 bases: 92993412(96.0684%)
Q30 bases: 78296469(80.8855%)

Read1 after filtering:
total reads: 40906
total bases: 2339618
Q20 bases: 2216703(94.7464%)
Q30 bases: 2003581(85.6371%)

Read2 after filtering:
total reads: 40906
total bases: 2410111
Q20 bases: 2357853(97.8317%)
Q30 bases: 2223586(92.2607%)

Filtering result:
reads passed filter: 81812
reads failed due to low quality: 40098
reads failed due to too many N: 8
reads failed due to too short: 1160190
reads with adapter trimmed: 670341
bases trimmed due to adapters: 95746524

Duplication rate: 54.6452%

Insert size peak (evaluated by paired-end reads): 31

JSON report: NTC_0001_0001_23LGNLLT4_2.fastp.json
HTML report: NTC_0001_0001_23LGNLLT4_2.fastp.html

fastp --in1 NTC_0001_0001_23LGNLLT4_2_1.fastq.gz --in2 NTC_0001_0001_23LGNLLT4_2_2.fastq.gz --out1 NTC_0001_0001_23LGNLLT4_2_1.fastp.fastq.gz --out2 NTC_0001_0001_23LGNLLT4_2_2.fastp.fastq.gz --json NTC_0001_0001_23LGNLLT4_2.fastp.json --html NTC_0001_0001_23LGNLLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 4 seconds