Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 30289170
total bases: 4573664670
Q20 bases: 4361535044(95.3619%)
Q30 bases: 4064247924(88.862%)

Read2 before filtering:
total reads: 30289170
total bases: 4573664670
Q20 bases: 4476319038(97.8716%)
Q30 bases: 4246115192(92.8384%)

Read1 after filtering:
total reads: 27400070
total bases: 2954966810
Q20 bases: 2942547719(99.5797%)
Q30 bases: 2889570190(97.7869%)

Read2 after filtering:
total reads: 27400070
total bases: 2961524673
Q20 bases: 2943685935(99.3977%)
Q30 bases: 2885588075(97.4359%)

Filtering result:
reads passed filter: 54800140
reads failed due to low quality: 740318
reads failed due to too many N: 4342
reads failed due to too short: 5033540
reads with adapter trimmed: 49779874
bases trimmed due to adapters: 2470506092

Duplication rate: 42.8011%

Insert size peak (evaluated by paired-end reads): 109

JSON report: tih_rna_sample_00531_23LGNLLT4_1.fastp.json
HTML report: tih_rna_sample_00531_23LGNLLT4_1.fastp.html

fastp --in1 tih_rna_sample_00531_23LGNLLT4_1_1.fastq.gz --in2 tih_rna_sample_00531_23LGNLLT4_1_2.fastq.gz --out1 tih_rna_sample_00531_23LGNLLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00531_23LGNLLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00531_23LGNLLT4_1.fastp.json --html tih_rna_sample_00531_23LGNLLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 48 seconds