Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 25247459
total bases: 3812366309
Q20 bases: 3626302486(95.1195%)
Q30 bases: 3293334006(86.3856%)

Read2 before filtering:
total reads: 25247459
total bases: 3812366309
Q20 bases: 3642288356(95.5388%)
Q30 bases: 3328815719(87.3163%)

Read1 after filtering:
total reads: 23280942
total bases: 1843506144
Q20 bases: 1827051466(99.1074%)
Q30 bases: 1779889959(96.5492%)

Read2 after filtering:
total reads: 23280942
total bases: 1872941246
Q20 bases: 1848515284(98.6959%)
Q30 bases: 1790781311(95.6133%)

Filtering result:
reads passed filter: 46561884
reads failed due to low quality: 1123612
reads failed due to too many N: 2262
reads failed due to too short: 2807160
reads with adapter trimmed: 45299511
bases trimmed due to adapters: 3423714669

Duplication rate: 43.3884%

Insert size peak (evaluated by paired-end reads): 84

JSON report: tih_rna_sample_00536_23LGNLLT4_1.fastp.json
HTML report: tih_rna_sample_00536_23LGNLLT4_1.fastp.html

fastp --in1 tih_rna_sample_00536_23LGNLLT4_1_1.fastq.gz --in2 tih_rna_sample_00536_23LGNLLT4_1_2.fastq.gz --out1 tih_rna_sample_00536_23LGNLLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00536_23LGNLLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00536_23LGNLLT4_1.fastp.json --html tih_rna_sample_00536_23LGNLLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 37 seconds