MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 15:16 UTC based on data in: /tmp/nxf.cYTZ4uawDb

General Statistics

Showing ⁴⁷⁵/₄₇₅ rows and ⁵⁵/₆₂ columns.

Sample Name	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_01_RNA_0002_23LGNLLT4_1	Yes	62.69%	592165102	0.00%	0.36%	376256232	0.91%	0.93%	0.09%	0.07%	341457548	173047358	32006810	12687752	727.92	321.00	0.73%	0.63%	0.97	0.000	163.2bp	148.0bp	0.10%	0.83%	0.43%	0.00%	0.22%	2.44%	0.62%	0.00%	9999000000	649515898				204bp	512bp	36.6%	0.0%	95.2%	89.1%	96.0%	284.2M	24.7%	97.3%	77295.7Mb	592.2M	55.5%	98.7%	45.5%
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_1																																	163.2bp	95.3%	282.2M																83.6%	54%	151bp	151bp	18%	522.9M
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_2																																																			83.7%	55%	151bp	151bp	18%	522.9M
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_trimmed_1																																																			79.7%	55%	134bp	151bp	18%	296.1M	79.7%	55%	134bp	151bp	18%	296.1M
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_trimmed_2																																																			80.8%	55%	134bp	151bp	18%	296.1M	80.8%	55%	134bp	151bp	18%	296.1M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2	Yes	62.59%	592194526	0.00%	0.37%	370672955	0.91%	0.93%	0.08%	0.07%	336393929	170447440	31493035	12473964	719.57	325.00	0.73%	0.64%	0.97	0.000	163.7bp	149.0bp	0.11%	0.82%	0.43%	0.00%	0.24%	2.44%	0.62%	0.00%	9999000000	633898399				209bp	545bp	37.6%	0.0%	95.3%	89.7%	96.2%	284.7M	24.9%	97.3%	77606.7Mb	592.2M	54.9%	98.7%	45.2%
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_1																																	163.7bp	95.5%	282.9M																83.2%	54%	151bp	151bp	27%	480.3M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_2																																																			83.0%	54%	151bp	151bp	18%	480.3M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_trimmed_1																																																			79.8%	54%	135bp	151bp	27%	296.1M	79.8%	54%	135bp	151bp	27%	296.1M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_trimmed_2																																																			80.6%	55%	135bp	151bp	18%	296.1M	80.6%	55%	135bp	151bp	18%	296.1M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3	Yes	63.05%	591293818	0.00%	0.39%	360889648	0.90%	0.92%	0.09%	0.08%	325300385	164588217	32710380	13371204	675.00	313.00	0.73%	0.63%	0.97	0.000	156.2bp	142.0bp	0.12%	0.83%	0.43%	0.00%	0.26%	2.46%	0.62%	0.00%	9999000000	600608353				189bp	480bp	39.2%	0.0%	95.2%	90.0%	96.2%	284.3M	25.1%	97.3%	76189.5Mb	591.3M	54.3%	98.5%	49.4%
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_1																																	156.2bp	95.4%	282.0M																84.1%	53%	151bp	151bp	27%	535.1M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_2																																																			83.8%	54%	151bp	151bp	18%	535.1M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_trimmed_1																																																			80.2%	54%	132bp	151bp	27%	295.6M	80.2%	54%	132bp	151bp	27%	295.6M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_trimmed_2																																																			80.8%	54%	132bp	151bp	18%	295.6M	80.8%	54%	132bp	151bp	18%	295.6M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1	Yes	61.65%	594651918	0.01%	0.43%	341553175	0.88%	0.91%	0.11%	0.09%	301250001	153201468	37126794	15469178	661.00	283.00	0.73%	0.63%	0.98	0.000	170.2bp	155.0bp	0.15%	1.70%	0.56%	0.00%	0.32%	4.98%	0.85%	0.00%	9999000000	476784704				225bp	559bp	42.8%	0.0%	93.8%	88.7%	95.8%	284.9M	32.0%	97.7%	80051.6Mb	594.7M	55.0%	99.1%	39.0%
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_1																																	170.2bp	93.8%	278.9M																84.5%	54%	151bp	151bp	27%	586.1M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_2																																																			84.3%	55%	151bp	151bp	18%	586.1M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_trimmed_1																																																			80.0%	54%	138bp	151bp	18%	297.3M	80.0%	54%	138bp	151bp	18%	297.3M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_trimmed_2																																																			80.5%	55%	138bp	151bp	9%	297.3M	80.5%	55%	138bp	151bp	9%	297.3M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1	Yes	33.28%	592823060	0.01%	0.33%	395016575	0.91%	0.93%	0.08%	0.07%	358497698	181595417	33210916	13300196	746.31	378.00	0.75%	0.66%	0.97	0.000	157.6bp	144.0bp	0.11%	0.95%	0.33%	0.00%	0.24%	2.91%	0.51%	0.00%	9999000000	768659482				182bp	416bp	33.6%	0.0%	95.2%	87.8%	95.4%	282.8M	20.7%	97.2%	76501.6Mb	592.8M	55.6%	98.8%	48.3%
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_1																																	157.6bp	95.3%	282.4M																84.7%	54%	151bp	151bp	18%	857.7M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_2																																																			84.5%	55%	151bp	151bp	18%	857.7M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_trimmed_1																																																			77.2%	55%	133bp	151bp	18%	296.4M	77.2%	55%	133bp	151bp	18%	296.4M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_trimmed_2																																																			78.1%	56%	133bp	151bp	18%	296.4M	78.1%	56%	133bp	151bp	18%	296.4M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2	Yes	31.72%	591684456	0.01%	0.35%	381832226	0.90%	0.93%	0.09%	0.07%	345028286	174565389	33574239	13654326	722.41	391.00	0.75%	0.66%	0.97	0.000	157.3bp	144.0bp	0.14%	0.93%	0.33%	0.00%	0.31%	2.89%	0.50%	0.00%	9999000000	697792974				186bp	455bp	35.7%	0.0%	95.1%	89.4%	95.8%	283.4M	23.1%	97.3%	76653.1Mb	591.7M	53.8%	98.6%	47.9%
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_1																																	157.3bp	95.4%	282.1M																83.9%	53%	151bp	151bp	27%	607.5M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_2																																																			83.9%	53%	151bp	151bp	18%	607.5M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_trimmed_1																																																			79.1%	53%	133bp	151bp	27%	295.8M	79.1%	53%	133bp	151bp	27%	295.8M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_trimmed_2																																																			80.1%	54%	133bp	151bp	18%	295.8M	80.1%	54%	133bp	151bp	18%	295.8M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3	Yes	31.83%	591327620	0.01%	0.36%	379242905	0.90%	0.92%	0.09%	0.08%	341468199	172687649	34569009	14279735	703.76	384.00	0.75%	0.66%	0.97	0.000	154.2bp	141.0bp	0.15%	0.95%	0.33%	0.00%	0.34%	2.93%	0.50%	0.00%	9999000000	693651072				177bp	423bp	36.1%	0.0%	94.9%	89.5%	95.8%	283.3M	23.5%	97.4%	75840.9Mb	591.3M	53.6%	98.6%	50.1%
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_1																																	154.2bp	95.2%	281.5M																84.2%	53%	151bp	151bp	27%	598.8M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_2																																																			83.9%	53%	151bp	151bp	18%	598.8M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_trimmed_1																																																			79.5%	53%	132bp	151bp	27%	295.7M	79.5%	53%	132bp	151bp	27%	295.7M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_trimmed_2																																																			80.3%	53%	132bp	151bp	18%	295.7M	80.3%	53%	132bp	151bp	18%	295.7M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1	No	0.00%	592319396	0.00%	0.40%	358172210	0.91%	0.93%	0.09%	0.07%	324894553	164583148	30557819	12231236	663.29	248.00	0.67%	0.59%	0.97	0.000	153.5bp	139.0bp	0.17%	1.04%	0.36%	0.00%	0.35%	3.05%	0.55%	0.00%	9999000000	594396252				177bp	403bp	39.7%	0.0%	95.3%	86.8%	95.5%	282.9M	25.9%	97.3%	75709.7Mb	592.3M	56.1%	98.7%	50.9%
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_1																																	153.5bp	95.3%	282.1M																85.4%	55%	151bp	151bp	18%	671.1M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_2																																																			85.3%	56%	151bp	151bp	18%	671.1M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_trimmed_1																																																			80.1%	55%	131bp	147bp	18%	296.2M	80.1%	55%	131bp	147bp	18%	296.2M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_trimmed_2																																																			81.0%	56%	131bp	147bp	18%	296.2M	81.0%	56%	131bp	147bp	18%	296.2M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2	No	0.00%	591081278	0.00%	0.40%	353621594	0.91%	0.93%	0.09%	0.07%	320124082	162025753	30829161	12454428	658.89	262.00	0.67%	0.60%	0.97	0.000	155.0bp	142.0bp	0.19%	1.04%	0.36%	0.00%	0.41%	3.10%	0.55%	0.00%	9999000000	568273577				183bp	442bp	40.4%	0.0%	95.4%	88.4%	95.9%	283.3M	27.0%	97.3%	76017.4Mb	591.1M	54.7%	98.5%	50.0%
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_1																																	155.0bp	95.5%	282.2M																84.7%	53%	151bp	151bp	27%	558.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_2																																																			84.5%	55%	151bp	151bp	18%	558.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_trimmed_1																																																			80.6%	54%	132bp	151bp	27%	295.5M	80.6%	54%	132bp	151bp	27%	295.5M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_trimmed_2																																																			81.6%	55%	132bp	151bp	18%	295.5M	81.6%	55%	132bp	151bp	18%	295.5M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3	No	0.00%	591151052	0.00%	0.40%	355121065	0.90%	0.93%	0.09%	0.07%	320913068	162497405	31521429	12688212	664.38	267.00	0.67%	0.60%	0.97	0.000	154.8bp	142.0bp	0.19%	1.03%	0.36%	0.00%	0.42%	3.08%	0.54%	0.00%	9999000000	585765686				185bp	452bp	40.1%	0.0%	95.3%	88.4%	95.9%	283.3M	25.8%	97.3%	76174.9Mb	591.2M	54.4%	98.5%	49.6%
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_1																																	154.8bp	95.4%	282.1M																84.6%	54%	151bp	151bp	27%	521.9M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_2																																																			84.3%	54%	151bp	151bp	18%	521.9M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_trimmed_1																																																			80.9%	54%	132bp	151bp	27%	295.6M	80.9%	54%	132bp	151bp	27%	295.6M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_trimmed_2																																																			81.7%	54%	132bp	151bp	18%	295.6M	81.7%	54%	132bp	151bp	18%	295.6M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1	No	0.00%	593982022	0.01%	0.51%	290400487	0.85%	0.88%	0.14%	0.12%	247621008	125763285	39407873	17290295	517.74	126.00	0.59%	0.52%	0.98	0.000	159.7bp	146.0bp	0.14%	1.58%	1.23%	0.00%	0.25%	4.31%	1.61%	0.00%	9999000000	331721683				204bp	503bp	51.4%	0.0%	92.9%	88.7%	95.7%	284.1M	37.8%	97.7%	78185.8Mb	594.0M	53.8%	99.0%	46.0%
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_1																																	159.7bp	92.4%	274.4M																85.0%	53%	151bp	151bp	27%	477.9M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_2																																																			84.6%	53%	151bp	151bp	18%	477.9M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_trimmed_1																																																			81.8%	53%	135bp	151bp	18%	297.0M	81.8%	53%	135bp	151bp	18%	297.0M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_trimmed_2																																																			82.2%	54%	135bp	151bp	9%	297.0M	82.2%	54%	135bp	151bp	9%	297.0M
NTC_0001_0001_23LGNLLT4_1	Skipped	N/A%	458422	0.39%	0.49%	235400	0.01%	0.03%	0.23%	0.97%	1830	862	53783	25921	0.00	0.00	0.00%	0.00%	0.94	0.000	42.5bp	31.0bp	0.00%	0.04%	0.02%	0.00%	0.00%	0.12%	0.01%	0.00%	9999000000	106835				23bp	24bp	80.0%	2.6%	6.3%	2.1%	9.8%	0.0M	65.5%	92.4%	28.8Mb	0.5M	66.7%	6.9%	52.5%
NTC_0001_0001_23LGNLLT4_1_1																																	42.5bp	2.3%	0.0M																96.9%	74%	151bp	151bp	45%	3.3M
NTC_0001_0001_23LGNLLT4_1_2																																																			95.4%	96%	151bp	151bp	55%	3.3M
NTC_0001_0001_23LGNLLT4_1_trimmed_1																																																			61.1%	64%	67bp	37bp	36%	0.2M	61.1%	64%	67bp	37bp	36%	0.2M
NTC_0001_0001_23LGNLLT4_1_trimmed_2																																																			61.4%	68%	69bp	37bp	36%	0.2M	61.4%	68%	69bp	37bp	36%	0.2M
NTC_0001_0001_23LGNLLT4_2	Skipped	N/A%	81812	0.30%	0.44%	45748	0.02%	0.03%	0.45%	0.97%	690	327	20466	9895	0.00	0.00	0.00%	0.00%	0.92	0.000	37.1bp	31.0bp	0.00%	0.00%	0.08%	0.00%	0.00%	0.00%	0.21%	0.00%	9999000000	70550				22bp	25bp	63.0%	2.7%	6.0%	2.3%	12.4%	0.0M	54.6%	89.0%	4.2Mb	0.1M	68.1%	6.4%	52.3%
NTC_0001_0001_23LGNLLT4_2_1																																	37.1bp	3.2%	0.0M																95.8%	75%	151bp	151bp	64%	0.6M
NTC_0001_0001_23LGNLLT4_2_2																																																			93.9%	97%	151bp	151bp	55%	0.6M
NTC_0001_0001_23LGNLLT4_2_trimmed_1																																																			50.4%	65%	57bp	32bp	36%	0.0M	50.4%	65%	57bp	32bp	36%	0.0M
NTC_0001_0001_23LGNLLT4_2_trimmed_2																																																			53.1%	71%	59bp	32bp	45%	0.0M	53.1%	71%	59bp	32bp	45%	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1	No	0.00%	590018694	0.01%	0.41%	345854243	0.88%	0.90%	0.11%	0.10%	303931196	153761937	38348573	16326658	615.24	172.00	0.61%	0.54%	0.97	0.000	150.9bp	138.0bp	0.15%	1.23%	0.74%	0.00%	0.29%	3.46%	0.97%	0.00%	9999000000	532295547				175bp	409bp	41.6%	0.0%	93.8%	88.7%	95.7%	282.2M	26.3%	97.3%	75122.3Mb	590.0M	53.5%	98.3%	52.2%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10	No	0.00%	589649974	0.01%	0.45%	326477618	0.87%	0.89%	0.12%	0.11%	282768522	142993381	39941376	17323475	558.89	158.00	0.61%	0.53%	0.97	0.000	148.1bp	135.0bp	0.14%	1.18%	0.71%	0.00%	0.27%	3.32%	0.92%	0.00%	9999000000	433589477				163bp	357bp	44.9%	0.0%	93.3%	88.5%	95.6%	281.8M	29.4%	97.3%	74247.1Mb	589.6M	53.3%	98.3%	54.7%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_1																																	148.1bp	93.3%	275.1M																80.9%	52%	151bp	151bp	27%	328.7M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_2																																																			80.5%	53%	151bp	151bp	18%	328.7M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_trimmed_1																																																			80.2%	53%	129bp	142bp	27%	294.8M	80.2%	53%	129bp	142bp	27%	294.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_trimmed_2																																																			80.8%	53%	129bp	142bp	18%	294.8M	80.8%	53%	129bp	142bp	18%	294.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11	No	0.00%	567630336	0.01%	0.47%	302243875	0.85%	0.88%	0.14%	0.12%	257687863	130282186	40881920	18088157	497.65	141.00	0.60%	0.53%	0.97	0.000	144.1bp	132.0bp	0.14%	1.12%	0.68%	0.00%	0.27%	3.17%	0.89%	0.00%	9999000000	391788283				154bp	310bp	47.1%	0.0%	92.8%	88.7%	95.7%	271.6M	29.3%	97.3%	70865.4Mb	567.6M	53.4%	98.4%	57.3%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_1																																	144.1bp	93.0%	263.8M																80.6%	52%	151bp	151bp	27%	288.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_2																																																			79.7%	53%	151bp	151bp	18%	288.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_trimmed_1																																																			80.6%	53%	128bp	137bp	18%	283.8M	80.6%	53%	128bp	137bp	18%	283.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_trimmed_2																																																			80.6%	53%	128bp	142bp	9%	283.8M	80.6%	53%	128bp	142bp	9%	283.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12	No	0.00%	452092264	0.01%	0.54%	208331638	0.82%	0.85%	0.16%	0.15%	171289203	86380873	33935410	15548299	302.03	80.00	0.57%	0.48%	0.97	0.000	130.7bp	121.0bp	0.17%	1.14%	0.70%	0.00%	0.32%	3.17%	0.88%	0.00%	9999000000	248989490				130bp	219bp	54.3%	0.0%	92.4%	87.1%	95.4%	215.6M	31.9%	97.3%	53530.6Mb	452.1M	53.5%	98.0%	67.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_1																																	130.7bp	92.5%	209.1M																80.8%	52%	151bp	151bp	27%	230.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_2																																																			78.8%	53%	151bp	151bp	18%	230.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_trimmed_1																																																			80.7%	53%	122bp	127bp	18%	226.0M	80.7%	53%	122bp	127bp	18%	226.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_trimmed_2																																																			79.8%	53%	122bp	127bp	9%	226.0M	79.8%	53%	122bp	127bp	9%	226.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13	No	0.00%	474369314	0.01%	0.47%	251307345	0.84%	0.87%	0.14%	0.13%	211999238	107022438	36137019	16273139	391.13	109.00	0.58%	0.51%	0.97	0.000	136.8bp	127.0bp	0.14%	1.10%	0.67%	0.00%	0.28%	3.07%	0.86%	0.00%	9999000000	348187974				140bp	250bp	47.3%	0.0%	92.4%	88.2%	95.5%	226.6M	27.7%	97.1%	57580.8Mb	474.4M	53.5%	98.1%	62.9%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_1																																	136.8bp	92.7%	219.8M																79.2%	52%	151bp	151bp	27%	241.7M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_2																																																			78.4%	53%	151bp	151bp	18%	241.7M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_trimmed_1																																																			79.2%	53%	125bp	132bp	18%	237.2M	79.2%	53%	125bp	132bp	18%	237.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_trimmed_2																																																			79.4%	53%	125bp	132bp	9%	237.2M	79.4%	53%	125bp	132bp	9%	237.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14	No	0.00%	477567290	0.01%	0.52%	231587419	0.82%	0.85%	0.16%	0.15%	190638439	96169724	37775856	17297527	341.56	93.00	0.58%	0.49%	0.97	0.000	131.9bp	122.0bp	0.17%	1.10%	0.67%	0.00%	0.33%	3.09%	0.85%	0.00%	9999000000	280471410				133bp	228bp	51.9%	0.0%	91.9%	88.5%	95.7%	228.4M	33.4%	97.3%	57063.3Mb	477.6M	52.8%	98.1%	65.9%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_1																																	131.9bp	92.2%	220.3M																80.3%	52%	151bp	151bp	27%	243.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_2																																																			78.5%	53%	151bp	151bp	18%	243.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_trimmed_1																																																			80.3%	52%	123bp	127bp	18%	238.8M	80.3%	52%	123bp	127bp	18%	238.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_trimmed_2																																																			79.5%	53%	123bp	127bp	9%	238.8M	79.5%	53%	123bp	127bp	9%	238.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15	No	0.00%	482917566	0.01%	0.49%	245317068	0.83%	0.86%	0.15%	0.14%	204100460	103028095	37872345	17197735	372.20	103.00	0.58%	0.50%	0.97	0.000	136.3bp	126.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	3.03%	0.86%	0.00%	9999000000	298729182				138bp	238bp	49.5%	0.0%	92.0%	87.6%	95.4%	230.4M	29.1%	97.2%	58363.8Mb	482.9M	53.7%	98.1%	63.7%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_1																																	136.3bp	92.3%	222.8M																79.1%	53%	151bp	151bp	27%	246.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_2																																																			78.2%	54%	151bp	151bp	18%	246.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_trimmed_1																																																			79.1%	53%	124bp	132bp	18%	241.5M	79.1%	53%	124bp	132bp	18%	241.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_trimmed_2																																																			79.1%	54%	124bp	132bp	9%	241.5M	79.1%	54%	124bp	132bp	9%	241.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16	No	0.00%	406204026	0.01%	0.47%	214776782	0.84%	0.86%	0.15%	0.14%	180643725	91111807	31347360	14220407	321.95	87.00	0.57%	0.49%	0.97	0.000	132.6bp	123.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	2.99%	0.85%	0.00%	9999000000	294674970				133bp	223bp	47.5%	0.0%	92.3%	87.7%	95.5%	193.9M	27.4%	97.1%	48588.2Mb	406.2M	53.9%	98.1%	66.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_1																																	132.6bp	92.6%	188.1M																78.1%	53%	151bp	151bp	27%	207.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_2																																																			77.0%	54%	151bp	151bp	18%	207.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_trimmed_1																																																			78.0%	53%	123bp	127bp	18%	203.1M	78.0%	53%	123bp	127bp	18%	203.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_trimmed_2																																																			77.9%	54%	123bp	127bp	9%	203.1M	77.9%	54%	123bp	127bp	9%	203.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17	No	0.00%	589652744	0.01%	0.45%	323997418	0.87%	0.90%	0.12%	0.10%	281731535	142397514	38358524	16636188	544.32	149.00	0.60%	0.53%	0.97	0.000	142.0bp	129.0bp	0.16%	1.25%	0.76%	0.00%	0.30%	3.47%	0.98%	0.00%	9999000000	442632707				154bp	323bp	45.4%	0.0%	93.7%	87.1%	95.2%	280.8M	28.0%	97.2%	72837.2Mb	589.7M	54.1%	98.3%	58.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_1																																	142.0bp	93.5%	275.6M																81.0%	53%	151bp	151bp	27%	314.6M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_2																																																			80.4%	54%	151bp	151bp	18%	314.6M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_trimmed_1																																																			80.7%	53%	127bp	137bp	18%	294.8M	80.7%	53%	127bp	137bp	18%	294.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_trimmed_2																																																			81.1%	54%	127bp	137bp	9%	294.8M	81.1%	54%	127bp	137bp	9%	294.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18	No	0.00%	527990902	0.01%	0.51%	260442942	0.85%	0.87%	0.14%	0.13%	220949191	111548673	36258322	16232312	407.12	109.00	0.59%	0.51%	0.97	0.000	135.3bp	124.0bp	0.18%	1.23%	0.74%	0.00%	0.34%	3.42%	0.93%	0.00%	9999000000	328051805				137bp	266bp	51.0%	0.0%	93.3%	88.4%	95.7%	252.5M	30.1%	97.4%	63336.8Mb	528.0M	53.2%	98.1%	64.0%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_1																																	135.3bp	93.3%	246.3M																81.9%	53%	151bp	151bp	27%	269.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_2																																																			80.4%	53%	151bp	151bp	18%	269.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_trimmed_1																																																			81.8%	52%	123bp	127bp	18%	264.0M	81.8%	52%	123bp	127bp	18%	264.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_trimmed_2																																																			81.3%	53%	123bp	132bp	9%	264.0M	81.3%	53%	123bp	132bp	9%	264.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19	No	0.00%	550580668	0.01%	0.47%	292535842	0.85%	0.87%	0.14%	0.13%	248464743	125517899	40378233	17997278	466.83	131.00	0.60%	0.52%	0.97	0.000	139.4bp	127.0bp	0.15%	1.17%	0.71%	0.00%	0.28%	3.26%	0.91%	0.00%	9999000000	374422857				143bp	272bp	47.2%	0.0%	92.7%	87.6%	95.4%	262.6M	28.9%	97.2%	67000.5Mb	550.6M	53.8%	98.1%	61.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_1																																	139.4bp	92.8%	255.4M																80.0%	53%	151bp	151bp	27%	280.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_2																																																			79.7%	54%	151bp	151bp	18%	280.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_trimmed_1																																																			80.0%	53%	125bp	132bp	18%	275.3M	80.0%	53%	125bp	132bp	18%	275.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_trimmed_2																																																			80.6%	54%	125bp	132bp	9%	275.3M	80.6%	54%	125bp	132bp	9%	275.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_1																																	150.9bp	93.8%	276.6M																82.0%	52%	151bp	151bp	27%	393.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_2																																																			81.6%	53%	151bp	151bp	18%	393.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_trimmed_1																																																			80.1%	53%	131bp	147bp	27%	295.0M	80.1%	53%	131bp	147bp	27%	295.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_trimmed_2																																																			80.7%	53%	131bp	147bp	18%	295.0M	80.7%	53%	131bp	147bp	18%	295.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2	No	0.00%	588985810	0.01%	0.46%	318114987	0.87%	0.90%	0.12%	0.10%	276967901	140032266	37387375	16117377	545.25	150.00	0.60%	0.53%	0.97	0.000	147.0bp	136.0bp	0.13%	1.17%	0.71%	0.00%	0.24%	3.28%	0.93%	0.00%	9999000000	401041837				163bp	351bp	46.3%	0.0%	93.7%	88.3%	95.6%	281.4M	28.9%	97.2%	74214.6Mb	589.0M	54.0%	98.2%	55.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20	No	0.00%	484467198	0.01%	0.50%	240255388	0.83%	0.86%	0.15%	0.14%	200535010	101172735	36488203	16580401	359.50	98.00	0.58%	0.50%	0.97	0.000	131.7bp	121.0bp	0.17%	1.15%	0.70%	0.00%	0.32%	3.19%	0.89%	0.00%	9999000000	301119541				132bp	228bp	50.7%	0.0%	92.5%	87.9%	95.5%	231.3M	29.3%	97.3%	57486.8Mb	484.5M	53.5%	98.1%	66.3%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_1																																	131.7bp	92.7%	224.4M																80.9%	53%	151bp	151bp	27%	247.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_2																																																			79.4%	54%	151bp	151bp	18%	247.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_trimmed_1																																																			80.9%	53%	122bp	127bp	18%	242.2M	80.9%	53%	122bp	127bp	18%	242.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_trimmed_2																																																			80.4%	53%	122bp	127bp	9%	242.2M	80.4%	53%	122bp	127bp	9%	242.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21	No	0.00%	318963200	0.01%	0.44%	179603075	0.85%	0.87%	0.14%	0.13%	152755041	77059888	24756128	11139301	277.90	74.00	0.56%	0.47%	0.97	0.000	134.1bp	124.0bp	0.16%	1.10%	0.67%	0.00%	0.29%	3.07%	0.86%	0.00%	9999000000	255207933				137bp	240bp	44.0%	0.0%	92.5%	88.5%	95.6%	152.5M	25.2%	97.2%	38497.0Mb	319.0M	53.6%	98.3%	64.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_1																																	134.1bp	92.8%	148.1M																77.5%	53%	151bp	151bp	27%	162.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_2																																																			75.8%	53%	151bp	151bp	18%	162.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_trimmed_1																																																			77.5%	53%	124bp	132bp	18%	159.5M	77.5%	53%	124bp	132bp	18%	159.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_trimmed_2																																																			76.6%	53%	124bp	132bp	9%	159.5M	76.6%	53%	124bp	132bp	9%	159.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22	No	0.00%	392842870	0.01%	0.46%	210363235	0.84%	0.86%	0.15%	0.14%	176883680	89202960	30764562	13949435	315.56	85.00	0.57%	0.49%	0.97	0.000	132.6bp	122.0bp	0.15%	1.11%	0.68%	0.00%	0.27%	3.08%	0.87%	0.00%	9999000000	279481365				132bp	221bp	46.8%	0.0%	92.3%	87.4%	95.4%	187.3M	26.4%	97.2%	46713.5Mb	392.8M	54.0%	98.0%	66.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_1																																	132.6bp	92.5%	181.8M																78.5%	53%	151bp	151bp	27%	200.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_2																																																			77.1%	54%	151bp	151bp	18%	200.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_trimmed_1																																																			78.4%	53%	122bp	127bp	18%	196.4M	78.4%	53%	122bp	127bp	18%	196.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_trimmed_2																																																			78.0%	54%	122bp	127bp	9%	196.4M	78.0%	54%	122bp	127bp	9%	196.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23	No	0.00%	450967944	0.01%	0.48%	234842705	0.84%	0.86%	0.15%	0.14%	197017307	99421898	34690577	15667592	358.21	98.00	0.58%	0.50%	0.97	0.000	135.8bp	126.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	3.00%	0.85%	0.00%	9999000000	297193964				137bp	236bp	48.3%	0.0%	92.2%	87.7%	95.4%	215.1M	31.0%	97.3%	54587.1Mb	451.0M	54.1%	98.1%	64.0%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_1																																	135.8bp	92.5%	208.6M																79.4%	53%	151bp	151bp	27%	229.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_2																																																			78.3%	54%	151bp	151bp	18%	229.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_trimmed_1																																																			79.4%	53%	124bp	132bp	18%	225.5M	79.4%	53%	124bp	132bp	18%	225.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_trimmed_2																																																			79.3%	54%	125bp	132bp	9%	225.5M	79.3%	54%	125bp	132bp	9%	225.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24	No	0.00%	518504562	0.01%	0.47%	274933470	0.84%	0.87%	0.15%	0.13%	231333627	116768503	40003008	17987873	422.89	117.00	0.59%	0.51%	0.97	0.000	136.4bp	126.0bp	0.13%	1.09%	0.67%	0.00%	0.25%	3.03%	0.88%	0.00%	9999000000	365620819				138bp	237bp	47.3%	0.0%	92.3%	86.9%	95.2%	246.9M	27.0%	97.3%	62647.7Mb	518.5M	54.3%	98.2%	63.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_1																																	136.4bp	92.5%	239.8M																79.1%	53%	151bp	151bp	27%	264.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_2																																																			78.6%	54%	151bp	151bp	18%	264.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_trimmed_1																																																			79.0%	54%	124bp	132bp	18%	259.3M	79.0%	54%	124bp	132bp	18%	259.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_trimmed_2																																																			79.6%	54%	124bp	132bp	9%	259.3M	79.6%	54%	124bp	132bp	9%	259.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_1																																	147.0bp	93.7%	276.0M																80.4%	53%	151bp	151bp	27%	300.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_2																																																			79.7%	54%	151bp	151bp	18%	300.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_trimmed_1																																																			80.4%	53%	130bp	142bp	18%	294.5M	80.4%	53%	130bp	142bp	18%	294.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_trimmed_2																																																			80.7%	54%	130bp	142bp	9%	294.5M	80.7%	54%	130bp	142bp	9%	294.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3	No	0.00%	518725984	0.01%	0.45%	287344441	0.86%	0.88%	0.13%	0.12%	245757255	124239143	38188549	16871578	475.96	134.00	0.60%	0.52%	0.97	0.000	144.5bp	133.0bp	0.13%	1.14%	0.68%	0.00%	0.25%	3.19%	0.89%	0.00%	9999000000	414363956				154bp	308bp	44.9%	0.0%	92.6%	88.1%	95.5%	247.8M	27.1%	97.0%	64593.8Mb	518.7M	53.5%	98.2%	57.3%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_1																																	144.5bp	92.7%	240.5M																79.3%	53%	151bp	151bp	27%	264.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_2																																																			78.7%	53%	151bp	151bp	18%	264.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_trimmed_1																																																			79.3%	53%	128bp	142bp	18%	259.4M	79.3%	53%	128bp	142bp	18%	259.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_trimmed_2																																																			79.6%	53%	128bp	142bp	9%	259.4M	79.6%	53%	128bp	142bp	9%	259.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4	No	0.00%	473640334	0.01%	0.43%	269293925	0.85%	0.88%	0.14%	0.12%	229640557	115960247	36469504	16263323	432.24	122.00	0.59%	0.52%	0.97	0.000	139.1bp	129.0bp	0.14%	1.12%	0.68%	0.00%	0.27%	3.14%	0.88%	0.00%	9999000000	382463541				145bp	269bp	43.4%	0.0%	92.4%	87.7%	95.4%	226.0M	26.0%	97.3%	58121.8Mb	473.6M	53.6%	98.1%	60.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_1																																	139.1bp	92.6%	219.3M																78.0%	53%	151bp	151bp	27%	241.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_2																																																			77.7%	53%	151bp	151bp	18%	241.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_trimmed_1																																																			78.0%	53%	126bp	137bp	18%	236.8M	78.0%	53%	126bp	137bp	18%	236.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_trimmed_2																																																			78.6%	53%	126bp	137bp	9%	236.8M	78.6%	53%	126bp	137bp	9%	236.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5	No	0.00%	468081018	0.01%	0.45%	259387759	0.85%	0.87%	0.14%	0.13%	219467856	110836818	36764549	16484661	413.89	117.00	0.59%	0.51%	0.97	0.000	140.8bp	129.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	3.04%	0.86%	0.00%	9999000000	356919715				146bp	267bp	44.9%	0.0%	92.2%	88.3%	95.6%	223.6M	27.4%	97.2%	57740.0Mb	468.1M	53.4%	98.1%	60.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_1																																	140.8bp	92.4%	216.3M																78.5%	53%	151bp	151bp	27%	238.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_2																																																			77.8%	53%	151bp	151bp	18%	238.5M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_trimmed_1																																																			78.5%	53%	127bp	137bp	18%	234.0M	78.5%	53%	127bp	137bp	18%	234.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_trimmed_2																																																			78.7%	53%	127bp	137bp	9%	234.0M	78.7%	53%	127bp	137bp	9%	234.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6	No	0.00%	469967582	0.01%	0.44%	262384136	0.85%	0.87%	0.14%	0.13%	222011068	112108873	37270404	16713427	418.91	119.00	0.59%	0.51%	0.97	0.000	141.1bp	131.0bp	0.13%	1.07%	0.65%	0.00%	0.26%	3.00%	0.85%	0.00%	9999000000	359037306				146bp	266bp	44.5%	0.0%	92.1%	88.3%	95.6%	224.6M	27.1%	97.2%	58161.4Mb	470.0M	53.4%	98.3%	60.2%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_1																																	141.1bp	92.4%	217.2M																77.9%	53%	151bp	151bp	27%	239.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_2																																																			77.4%	53%	151bp	151bp	18%	239.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_trimmed_1																																																			77.9%	53%	127bp	137bp	18%	235.0M	77.9%	53%	127bp	137bp	18%	235.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_trimmed_2																																																			78.4%	53%	127bp	137bp	9%	235.0M	78.4%	53%	127bp	137bp	9%	235.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7	No	0.00%	480860960	0.01%	0.48%	247754034	0.84%	0.87%	0.14%	0.13%	208765482	105386966	35717546	16071724	384.30	106.00	0.58%	0.50%	0.97	0.000	136.8bp	127.0bp	0.13%	1.07%	0.66%	0.00%	0.25%	3.00%	0.85%	0.00%	9999000000	304925542				141bp	250bp	48.8%	0.0%	92.5%	87.7%	95.5%	229.5M	29.6%	97.3%	58646.8Mb	480.9M	53.8%	98.1%	62.2%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_1																																	136.8bp	92.7%	223.0M																78.8%	53%	151bp	151bp	27%	245.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_2																																																			78.1%	53%	151bp	151bp	18%	245.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_trimmed_1																																																			78.8%	53%	125bp	132bp	18%	240.4M	78.8%	53%	125bp	132bp	18%	240.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_trimmed_2																																																			79.1%	54%	125bp	132bp	9%	240.4M	79.1%	54%	125bp	132bp	9%	240.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8	No	0.00%	377546222	0.01%	0.47%	200095797	0.84%	0.86%	0.15%	0.14%	167750342	84564227	29834051	13607161	295.49	79.00	0.57%	0.48%	0.97	0.000	131.3bp	122.0bp	0.16%	1.09%	0.67%	0.00%	0.29%	3.03%	0.86%	0.00%	9999000000	269021822				130bp	214bp	47.3%	0.0%	92.2%	87.9%	95.5%	180.3M	27.1%	97.2%	44786.6Mb	377.5M	53.6%	98.1%	67.9%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_1																																	131.3bp	92.5%	174.7M																77.6%	53%	151bp	151bp	27%	192.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_2																																																			76.4%	54%	151bp	151bp	18%	192.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_trimmed_1																																																			77.6%	53%	122bp	127bp	18%	188.8M	77.6%	53%	122bp	127bp	18%	188.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_trimmed_2																																																			77.3%	53%	122bp	127bp	9%	188.8M	77.3%	53%	122bp	127bp	9%	188.8M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9	Yes	0.00%	590065164	0.01%	0.43%	335514884	0.88%	0.90%	0.11%	0.10%	295073866	149239387	36794369	15666172	585.00	160.00	0.61%	0.53%	0.97	0.000	148.5bp	136.0bp	0.14%	1.24%	0.75%	0.00%	0.27%	3.47%	0.97%	0.00%	9999000000	493844498				166bp	375bp	43.4%	0.0%	94.1%	88.1%	95.5%	281.9M	26.7%	97.3%	74214.3Mb	590.1M	54.0%	98.3%	54.8%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_1																																	148.5bp	94.0%	277.3M																83.1%	53%	151bp	151bp	27%	438.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_2																																																			82.3%	54%	151bp	151bp	18%	438.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_trimmed_1																																																			80.5%	53%	129bp	142bp	27%	295.0M	80.5%	53%	129bp	142bp	27%	295.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_trimmed_2																																																			80.8%	54%	129bp	142bp	9%	295.0M	80.8%	54%	129bp	142bp	9%	295.0M
tih_rna_sample_00017_23LGNLLT4_1	No	0.00%	592841454	0.01%	0.53%	279719459	0.85%	0.88%	0.13%	0.12%	238883118	120492425	37506938	16987951	438.66	219.00	0.74%	0.62%	0.97	0.000	133.8bp	124.0bp	0.06%	0.32%	0.28%	0.00%	0.13%	1.10%	0.40%	0.00%	9999000000	370159588				149bp	285bp	53.1%	0.0%	93.6%	90.7%	96.2%	285.0M	32.6%	97.3%	71856.3Mb	592.8M	55.0%	98.8%	64.2%
tih_rna_sample_00017_23LGNLLT4_1_1																																	133.8bp	94.3%	279.4M																81.8%	54%	151bp	151bp	27%	342.0M
tih_rna_sample_00017_23LGNLLT4_1_2																																																			80.5%	54%	151bp	151bp	18%	342.0M
tih_rna_sample_00017_23LGNLLT4_1_trimmed_1																																																			80.9%	54%	125bp	132bp	27%	296.4M	80.9%	54%	125bp	132bp	27%	296.4M
tih_rna_sample_00017_23LGNLLT4_1_trimmed_2																																																			80.2%	55%	125bp	132bp	18%	296.4M	80.2%	55%	125bp	132bp	18%	296.4M
tih_rna_sample_00038_23LGNLLT4_1	No	0.00%	411341566	0.01%	0.48%	215197545	0.83%	0.86%	0.15%	0.14%	178963401	90209447	32747582	15025887	323.44	151.00	0.71%	0.57%	0.97	0.000	134.9bp	127.0bp	0.23%	0.71%	0.26%	0.00%	0.49%	2.19%	0.41%	0.00%	9999000000	286481389				137bp	208bp	48.1%	0.0%	91.7%	82.8%	93.9%	193.1M	28.0%	97.1%	49929.8Mb	411.3M	56.9%	98.0%	64.1%
tih_rna_sample_00038_23LGNLLT4_1_1																																	134.9bp	92.0%	189.3M																74.1%	55%	151bp	151bp	27%	209.9M
tih_rna_sample_00038_23LGNLLT4_1_2																																																			73.6%	56%	151bp	151bp	18%	209.9M
tih_rna_sample_00038_23LGNLLT4_1_trimmed_1																																																			74.0%	56%	125bp	132bp	18%	205.7M	74.0%	56%	125bp	132bp	18%	205.7M
tih_rna_sample_00038_23LGNLLT4_1_trimmed_2																																																			74.4%	57%	125bp	132bp	9%	205.7M	74.4%	57%	125bp	132bp	9%	205.7M
tih_rna_sample_00067_23LGNLLT4_1	Yes	0.00%	589394208	0.01%	0.52%	280291845	0.86%	0.89%	0.12%	0.11%	239654113	120612818	34362288	15576952	403.57	170.00	0.74%	0.59%	0.97	0.000	122.6bp	116.0bp	0.19%	0.35%	0.23%	0.00%	0.40%	1.11%	0.35%	0.00%	9999000000	347241097				123bp	179bp	53.0%	0.0%	94.1%	82.1%	92.9%	273.7M	27.7%	97.2%	68111.9Mb	589.4M	57.7%	98.2%	73.0%
tih_rna_sample_00067_23LGNLLT4_1_1																																	122.6bp	94.5%	278.4M																78.5%	55%	151bp	151bp	27%	315.7M
tih_rna_sample_00067_23LGNLLT4_1_2																																																			77.6%	56%	151bp	151bp	27%	315.7M
tih_rna_sample_00067_23LGNLLT4_1_trimmed_1																																																			78.0%	57%	119bp	122bp	18%	294.7M	78.0%	57%	119bp	122bp	18%	294.7M
tih_rna_sample_00067_23LGNLLT4_1_trimmed_2																																																			77.9%	57%	119bp	122bp	9%	294.7M	77.9%	57%	119bp	122bp	9%	294.7M
tih_rna_sample_00142_23LGNLLT4_1	No	0.00%	496050856	0.01%	0.45%	274343772	0.81%	0.84%	0.17%	0.16%	223468247	112609764	47183197	21966382	391.28	174.00	0.71%	0.59%	0.97	0.000	130.1bp	122.0bp	0.74%	0.19%	0.14%	0.00%	1.51%	0.58%	0.20%	0.00%	9999000000	409750990				129bp	187bp	45.0%	0.0%	90.5%	86.4%	95.0%	235.7M	24.5%	97.1%	58888.0Mb	496.1M	55.0%	98.1%	67.5%
tih_rna_sample_00142_23LGNLLT4_1_1																																	130.1bp	90.9%	225.5M																73.4%	54%	151bp	151bp	27%	252.8M
tih_rna_sample_00142_23LGNLLT4_1_2																																																			72.9%	54%	151bp	151bp	18%	252.8M
tih_rna_sample_00142_23LGNLLT4_1_trimmed_1																																																			73.4%	54%	122bp	127bp	18%	248.0M	73.4%	54%	122bp	127bp	18%	248.0M
tih_rna_sample_00142_23LGNLLT4_1_trimmed_2																																																			73.7%	55%	122bp	127bp	9%	248.0M	73.7%	55%	122bp	127bp	9%	248.0M
tih_rna_sample_00143_23LGNLLT4_1	Yes	0.00%	467049852	0.01%	0.48%	243893045	0.84%	0.86%	0.15%	0.14%	203727961	102568873	36927937	17039062	354.84	173.00	0.73%	0.60%	0.97	0.000	128.9bp	121.0bp	0.11%	0.91%	0.24%	0.00%	0.24%	2.79%	0.39%	0.00%	9999000000	316217031				127bp	187bp	48.1%	0.0%	92.3%	85.8%	94.9%	221.5M	26.7%	97.1%	54990.8Mb	467.0M	55.8%	98.1%	68.9%
tih_rna_sample_00143_23LGNLLT4_1_1																																	128.9bp	92.7%	216.4M																74.6%	54%	151bp	151bp	27%	238.1M
tih_rna_sample_00143_23LGNLLT4_1_2																																																			74.1%	55%	151bp	151bp	18%	238.1M
tih_rna_sample_00143_23LGNLLT4_1_trimmed_1																																																			74.5%	55%	121bp	127bp	18%	233.5M	74.5%	55%	121bp	127bp	18%	233.5M
tih_rna_sample_00143_23LGNLLT4_1_trimmed_2																																																			75.0%	56%	121bp	127bp	9%	233.5M	75.0%	56%	121bp	127bp	9%	233.5M
tih_rna_sample_00144_23LGNLLT4_1	No	0.00%	590490582	0.01%	0.42%	340860609	0.88%	0.91%	0.11%	0.09%	300771549	151720492	36114832	15782182	561.30	271.00	0.77%	0.66%	0.97	0.000	136.0bp	126.0bp	0.11%	0.35%	0.24%	0.00%	0.23%	1.07%	0.36%	0.00%	9999000000	527149659				144bp	275bp	42.6%	0.0%	94.3%	87.6%	95.3%	281.4M	23.9%	97.3%	71878.0Mb	590.5M	54.7%	98.4%	62.6%
tih_rna_sample_00144_23LGNLLT4_1_1																																	136.0bp	94.6%	279.2M																80.2%	54%	151bp	151bp	27%	399.3M
tih_rna_sample_00144_23LGNLLT4_1_2																																																			79.6%	54%	151bp	151bp	18%	399.3M
tih_rna_sample_00144_23LGNLLT4_1_trimmed_1																																																			77.9%	54%	125bp	132bp	27%	295.2M	77.9%	54%	125bp	132bp	27%	295.2M
tih_rna_sample_00144_23LGNLLT4_1_trimmed_2																																																			78.1%	54%	125bp	132bp	18%	295.2M	78.1%	54%	125bp	132bp	18%	295.2M
tih_rna_sample_00270_23LGNLLT4_1	No	0.00%	543983302	0.01%	0.66%	182897945	0.81%	0.85%	0.16%	0.15%	148958601	74980527	29711413	13743913	248.49	109.00	0.68%	0.52%	0.97	0.000	126.6bp	119.0bp	0.10%	0.41%	0.26%	0.00%	0.23%	1.29%	0.36%	0.00%	9999000000	200469006				128bp	200bp	66.9%	0.0%	94.6%	86.7%	95.0%	258.5M	40.2%	97.3%	64038.0Mb	544.0M	56.2%	98.2%	71.5%
tih_rna_sample_00270_23LGNLLT4_1_1																																	126.6bp	94.8%	257.8M																82.1%	55%	151bp	151bp	27%	277.0M
tih_rna_sample_00270_23LGNLLT4_1_2																																																			80.1%	55%	151bp	151bp	18%	277.0M
tih_rna_sample_00270_23LGNLLT4_1_trimmed_1																																																			82.1%	55%	121bp	122bp	18%	272.0M	82.1%	55%	121bp	122bp	18%	272.0M
tih_rna_sample_00270_23LGNLLT4_1_trimmed_2																																																			81.0%	56%	121bp	122bp	9%	272.0M	81.0%	56%	121bp	122bp	9%	272.0M
tih_rna_sample_00276_23LGNLLT4_1	No	0.00%	490246904	0.01%	0.46%	263458043	0.85%	0.87%	0.14%	0.13%	222647359	111966113	37136406	17123507	389.37	185.00	0.75%	0.61%	0.97	0.000	128.8bp	122.0bp	0.04%	0.29%	0.22%	0.00%	0.10%	1.05%	0.36%	0.00%	9999000000	392379665				133bp	207bp	46.6%	0.0%	92.3%	87.3%	95.2%	233.3M	25.3%	97.2%	58190.4Mb	490.2M	56.0%	98.0%	68.4%
tih_rna_sample_00276_23LGNLLT4_1_1																																	128.8bp	93.2%	228.5M																74.7%	55%	151bp	151bp	27%	250.1M
tih_rna_sample_00276_23LGNLLT4_1_2																																																			73.7%	56%	151bp	151bp	18%	250.1M
tih_rna_sample_00276_23LGNLLT4_1_trimmed_1																																																			74.6%	55%	122bp	127bp	18%	245.1M	74.6%	55%	122bp	127bp	18%	245.1M
tih_rna_sample_00276_23LGNLLT4_1_trimmed_2																																																			74.6%	56%	122bp	127bp	9%	245.1M	74.6%	56%	122bp	127bp	9%	245.1M
tih_rna_sample_00298_23LGNLLT4_1	Yes	0.00%	594574380	0.01%	0.43%	339462043	0.86%	0.88%	0.13%	0.12%	290927350	147239511	44798299	20204177	577.03	296.00	0.76%	0.66%	0.98	0.000	147.0bp	137.0bp	0.46%	0.95%	0.53%	0.00%	1.02%	2.90%	0.74%	0.00%	9999000000	471864590				161bp	311bp	43.2%	0.0%	92.4%	86.2%	94.9%	282.0M	29.1%	97.7%	76450.6Mb	594.6M	54.7%	99.1%	53.3%
tih_rna_sample_00298_23LGNLLT4_1_1																																	147.0bp	92.6%	275.3M																78.9%	54%	151bp	151bp	27%	415.1M
tih_rna_sample_00298_23LGNLLT4_1_2																																																			78.2%	54%	151bp	151bp	18%	415.1M
tih_rna_sample_00298_23LGNLLT4_1_trimmed_1																																																			76.2%	54%	132bp	147bp	18%	297.3M	76.2%	54%	132bp	147bp	18%	297.3M
tih_rna_sample_00298_23LGNLLT4_1_trimmed_2																																																			76.1%	54%	132bp	147bp	9%	297.3M	76.1%	54%	132bp	147bp	9%	297.3M
tih_rna_sample_00303_23LGNLLT4_1	No	0.00%	594173350	0.01%	0.55%	269334006	0.79%	0.82%	0.19%	0.18%	213724660	107955802	51092543	24132314	387.15	205.00	0.76%	0.63%	0.98	0.000	134.9bp	128.0bp	0.14%	1.06%	0.45%	0.00%	0.29%	3.09%	0.64%	0.00%	9999000000	294586956				141bp	235bp	55.1%	0.0%	90.8%	87.0%	94.9%	281.9M	37.2%	97.7%	73349.5Mb	594.2M	54.1%	99.0%	64.0%
tih_rna_sample_00303_23LGNLLT4_1_1																																	134.9bp	90.9%	269.9M																78.4%	53%	151bp	151bp	27%	330.7M
tih_rna_sample_00303_23LGNLLT4_1_2																																																			77.5%	54%	151bp	151bp	18%	330.7M
tih_rna_sample_00303_23LGNLLT4_1_trimmed_1																																																			77.5%	53%	126bp	132bp	18%	297.1M	77.5%	53%	126bp	132bp	18%	297.1M
tih_rna_sample_00303_23LGNLLT4_1_trimmed_2																																																			77.2%	54%	126bp	132bp	9%	297.1M	77.2%	54%	126bp	132bp	9%	297.1M
tih_rna_sample_00307_23LGNLLT4_1	No	0.00%	594331596	0.01%	0.60%	236629466	0.79%	0.81%	0.20%	0.19%	187054022	94494277	46498477	21963988	343.95	178.00	0.73%	0.60%	0.98	0.000	136.5bp	128.0bp	0.16%	0.59%	0.36%	0.00%	0.36%	2.00%	0.58%	0.00%	9999000000	242392266				152bp	293bp	60.5%	0.0%	91.4%	89.9%	96.1%	285.7M	42.5%	97.7%	73819.7Mb	594.3M	54.0%	99.1%	62.3%
tih_rna_sample_00307_23LGNLLT4_1_1																																	136.5bp	91.9%	273.1M																80.9%	53%	151bp	151bp	27%	302.3M
tih_rna_sample_00307_23LGNLLT4_1_2																																																			79.8%	54%	151bp	151bp	18%	302.3M
tih_rna_sample_00307_23LGNLLT4_1_trimmed_1																																																			80.9%	53%	127bp	137bp	18%	297.2M	80.9%	53%	127bp	137bp	18%	297.2M
tih_rna_sample_00307_23LGNLLT4_1_trimmed_2																																																			80.3%	54%	127bp	137bp	9%	297.2M	80.3%	54%	127bp	137bp	9%	297.2M
tih_rna_sample_00308_23LGNLLT4_1	No	0.00%	537117680	0.01%	0.60%	214293453	0.72%	0.75%	0.26%	0.25%	155232134	78207594	54855787	26569269	248.75	117.00	0.69%	0.53%	0.98	0.000	118.6bp	114.0bp	0.38%	0.91%	0.39%	0.00%	0.78%	2.72%	0.57%	0.00%	9999000000	233286475				121bp	173bp	60.6%	0.0%	89.1%	85.2%	94.8%	254.6M	40.5%	97.7%	61376.8Mb	537.1M	53.1%	98.8%	76.5%
tih_rna_sample_00308_23LGNLLT4_1_1																																	118.6bp	89.1%	239.3M																77.7%	53%	151bp	151bp	27%	271.8M
tih_rna_sample_00308_23LGNLLT4_1_2																																																			76.4%	53%	151bp	151bp	27%	271.8M
tih_rna_sample_00308_23LGNLLT4_1_trimmed_1																																																			77.7%	53%	117bp	117bp	18%	268.6M	77.7%	53%	117bp	117bp	18%	268.6M
tih_rna_sample_00308_23LGNLLT4_1_trimmed_2																																																			77.0%	53%	117bp	117bp	9%	268.6M	77.0%	53%	117bp	117bp	9%	268.6M
tih_rna_sample_00309_23LGNLLT4_1	Yes	0.37%	594568160	0.01%	0.46%	319904146	0.84%	0.86%	0.15%	0.14%	268533783	136001998	48250155	21999272	530.47	301.00	0.79%	0.68%	0.98	0.000	146.7bp	136.0bp	0.19%	0.90%	0.38%	0.00%	0.42%	2.91%	0.59%	0.00%	9999000000	409156183				161bp	298bp	46.4%	0.0%	91.5%	87.4%	95.3%	283.3M	33.6%	97.8%	76622.2Mb	594.6M	54.3%	99.1%	52.8%
tih_rna_sample_00309_23LGNLLT4_1_1																																	146.7bp	92.0%	273.4M																80.5%	53%	151bp	151bp	27%	427.4M
tih_rna_sample_00309_23LGNLLT4_1_2																																																			79.7%	54%	151bp	151bp	18%	427.4M
tih_rna_sample_00309_23LGNLLT4_1_trimmed_1																																																			77.7%	54%	132bp	147bp	18%	297.3M	77.7%	54%	132bp	147bp	18%	297.3M
tih_rna_sample_00309_23LGNLLT4_1_trimmed_2																																																			77.4%	54%	132bp	147bp	9%	297.3M	77.4%	54%	132bp	147bp	9%	297.3M
tih_rna_sample_00312_23LGNLLT4_1	No	0.00%	592628356	0.01%	0.61%	230023308	0.76%	0.79%	0.21%	0.21%	175475042	88298363	48693787	23490212	260.00	100.00	0.67%	0.50%	0.98	0.000	110.2bp	106.0bp	0.18%	0.84%	0.51%	0.00%	0.34%	2.34%	0.66%	0.00%	9999000000	244001365				110bp	142bp	61.8%	0.0%	91.3%	79.5%	93.1%	275.9M	32.8%	97.6%	63848.2Mb	592.6M	56.6%	98.8%	84.0%
tih_rna_sample_00312_23LGNLLT4_1_1																																	110.2bp	90.2%	267.2M																80.8%	54%	151bp	151bp	27%	411.3M
tih_rna_sample_00312_23LGNLLT4_1_2																																																			79.8%	55%	151bp	151bp	36%	411.3M
tih_rna_sample_00312_23LGNLLT4_1_trimmed_1																																																			78.0%	56%	110bp	112bp	18%	296.3M	78.0%	56%	110bp	112bp	18%	296.3M
tih_rna_sample_00312_23LGNLLT4_1_trimmed_2																																																			77.5%	56%	110bp	112bp	9%	296.3M	77.5%	56%	110bp	112bp	9%	296.3M
tih_rna_sample_00317_23LGNLLT4_1	No	0.00%	459987866	0.01%	0.79%	94644505	0.61%	0.65%	0.35%	0.35%	57790582	29404978	33053124	15789181	107.39	49.00	0.60%	0.32%	0.98	0.000	151.1bp	143.0bp	0.70%	0.36%	0.36%	0.00%	1.30%	1.05%	0.52%	0.00%	9999000000	97625948				157bp	241bp	80.1%	0.0%	89.5%	84.7%	94.2%	216.6M	63.5%	97.6%	60064.5Mb	460.0M	56.1%	98.2%	50.3%
tih_rna_sample_00317_23LGNLLT4_1_1																																	151.1bp	90.0%	207.0M																84.8%	55%	151bp	151bp	27%	234.2M
tih_rna_sample_00317_23LGNLLT4_1_2																																																			83.4%	56%	151bp	151bp	18%	234.2M
tih_rna_sample_00317_23LGNLLT4_1_trimmed_1																																																			84.7%	55%	134bp	151bp	18%	230.0M	84.7%	55%	134bp	151bp	18%	230.0M
tih_rna_sample_00317_23LGNLLT4_1_trimmed_2																																																			84.1%	56%	134bp	151bp	9%	230.0M	84.1%	56%	134bp	151bp	9%	230.0M
tih_rna_sample_00319_23LGNLLT4_1	Yes	0.00%	594367632	0.01%	0.45%	324548490	0.87%	0.90%	0.11%	0.10%	283941745	143610072	37290285	16589485	558.25	266.00	0.73%	0.63%	0.98	0.000	145.1bp	134.0bp	0.30%	1.18%	0.62%	0.00%	0.64%	3.52%	0.88%	0.00%	9999000000	449010602				164bp	360bp	45.7%	0.0%	94.3%	86.9%	94.9%	282.2M	30.8%	97.7%	75320.9Mb	594.4M	54.2%	99.1%	55.8%
tih_rna_sample_00319_23LGNLLT4_1_1																																	145.1bp	94.2%	279.9M																83.0%	53%	151bp	151bp	27%	487.9M
tih_rna_sample_00319_23LGNLLT4_1_2																																																			82.0%	54%	151bp	151bp	18%	487.9M
tih_rna_sample_00319_23LGNLLT4_1_trimmed_1																																																			79.4%	53%	130bp	142bp	18%	297.2M	79.4%	53%	130bp	142bp	18%	297.2M
tih_rna_sample_00319_23LGNLLT4_1_trimmed_2																																																			79.0%	54%	130bp	142bp	9%	297.2M	79.0%	54%	130bp	142bp	9%	297.2M
tih_rna_sample_00321_23LGNLLT4_1	Yes	0.00%	593244928	0.01%	0.53%	280606323	0.83%	0.86%	0.15%	0.14%	233795398	117847126	41782478	19576610	398.51	138.00	0.69%	0.55%	0.98	0.000	125.7bp	120.0bp	0.09%	0.82%	0.39%	0.00%	0.18%	2.40%	0.56%	0.00%	9999000000	334302738				130bp	196bp	53.2%	0.0%	92.8%	82.2%	93.7%	278.0M	32.0%	97.6%	70109.4Mb	593.2M	58.5%	98.9%	71.7%
tih_rna_sample_00321_23LGNLLT4_1_1																																	125.7bp	92.3%	273.8M																81.7%	57%	151bp	151bp	27%	486.8M
tih_rna_sample_00321_23LGNLLT4_1_2																																																			81.3%	57%	151bp	151bp	18%	486.8M
tih_rna_sample_00321_23LGNLLT4_1_trimmed_1																																																			77.6%	58%	121bp	122bp	18%	296.6M	77.6%	58%	121bp	122bp	18%	296.6M
tih_rna_sample_00321_23LGNLLT4_1_trimmed_2																																																			78.0%	58%	121bp	127bp	9%	296.6M	78.0%	58%	121bp	127bp	9%	296.6M
tih_rna_sample_00322_23LGNLLT4_1	No	0.00%	592599476	0.07%	0.59%	243224439	0.72%	0.87%	0.11%	0.13%	174400256	87990336	27822066	12815223	305.62	85.00	0.65%	0.47%	0.98	0.000	129.8bp	122.0bp	0.05%	0.53%	0.51%	0.00%	0.11%	1.71%	0.79%	0.00%	9999000000	200881697				144bp	247bp	63.3%	0.0%	94.2%	78.2%	88.4%	261.9M	41.6%	97.5%	70861.7Mb	592.6M	60.8%	98.8%	67.5%
tih_rna_sample_00322_23LGNLLT4_1_1																																	129.8bp	87.6%	259.5M																85.2%	59%	151bp	151bp	27%	363.3M
tih_rna_sample_00322_23LGNLLT4_1_2																																																			84.3%	59%	151bp	151bp	18%	363.3M
tih_rna_sample_00322_23LGNLLT4_1_trimmed_1																																																			83.9%	60%	123bp	127bp	18%	296.3M	83.9%	60%	123bp	127bp	18%	296.3M
tih_rna_sample_00322_23LGNLLT4_1_trimmed_2																																																			83.7%	60%	123bp	127bp	9%	296.3M	83.7%	60%	123bp	127bp	9%	296.3M
tih_rna_sample_00323_23LGNLLT4_1	No	0.00%	425818228	0.01%	0.73%	114970167	0.50%	0.53%	0.46%	0.47%	57823859	29092563	52515731	25887795	84.11	37.00	0.55%	0.26%	0.98	0.000	111.8bp	107.0bp	0.14%	0.89%	0.39%	0.00%	0.32%	2.86%	0.60%	0.00%	9999000000	129974950				111bp	144bp	73.8%	0.0%	85.5%	81.7%	94.0%	200.1M	44.5%	97.6%	46344.4Mb	425.8M	54.0%	98.0%	82.1%
tih_rna_sample_00323_23LGNLLT4_1_1																																	111.8bp	85.2%	181.5M																80.4%	53%	151bp	151bp	27%	217.2M
tih_rna_sample_00323_23LGNLLT4_1_2																																																			78.3%	54%	151bp	151bp	36%	217.2M
tih_rna_sample_00323_23LGNLLT4_1_trimmed_1																																																			80.3%	53%	111bp	112bp	18%	212.9M	80.3%	53%	111bp	112bp	18%	212.9M
tih_rna_sample_00323_23LGNLLT4_1_trimmed_2																																																			79.0%	54%	112bp	112bp	9%	212.9M	79.0%	54%	112bp	112bp	9%	212.9M
tih_rna_sample_00331_23LGNLLT4_1	No	0.00%	590786076	0.01%	0.77%	134297140	0.42%	0.44%	0.54%	0.56%	56103096	28265366	72012953	35584711	82.37	35.00	0.53%	0.24%	0.98	0.000	116.5bp	112.0bp	0.15%	0.80%	0.27%	0.00%	0.34%	2.56%	0.42%	0.00%	9999000000	158897302				116bp	145bp	78.1%	0.0%	84.6%	83.1%	94.1%	278.1M	50.9%	97.7%	66817.5Mb	590.8M	54.4%	98.5%	78.6%
tih_rna_sample_00331_23LGNLLT4_1_1																																	116.5bp	84.9%	250.7M																83.6%	53%	151bp	151bp	27%	338.1M
tih_rna_sample_00331_23LGNLLT4_1_2																																																			81.8%	54%	151bp	151bp	27%	338.1M
tih_rna_sample_00331_23LGNLLT4_1_trimmed_1																																																			82.7%	54%	116bp	117bp	18%	295.4M	82.7%	54%	116bp	117bp	18%	295.4M
tih_rna_sample_00331_23LGNLLT4_1_trimmed_2																																																			81.6%	54%	116bp	117bp	9%	295.4M	81.6%	54%	116bp	117bp	9%	295.4M
tih_rna_sample_00332_23LGNLLT4_1	No	0.00%	210343906	0.01%	0.88%	24689891	0.54%	0.62%	0.34%	0.38%	13353558	6725804	8305112	4038654	20.05	2.00	0.13%	0.03%	0.97	0.000	116.5bp	111.0bp	0.06%	0.21%	0.16%	0.00%	0.14%	0.85%	0.36%	0.00%	9999000000	22810987				183bp	309bp	89.6%	0.0%	93.5%	78.7%	93.1%	97.9M	59.0%	97.2%	23638.2Mb	210.3M	64.7%	97.3%	76.9%
tih_rna_sample_00332_23LGNLLT4_1_1																																	116.5bp	92.4%	97.2M																90.7%	61%	151bp	151bp	27%	108.1M
tih_rna_sample_00332_23LGNLLT4_1_2																																																			89.2%	62%	151bp	151bp	55%	108.1M
tih_rna_sample_00332_23LGNLLT4_1_trimmed_1																																																			90.8%	64%	115bp	117bp	18%	105.2M	90.8%	64%	115bp	117bp	18%	105.2M
tih_rna_sample_00332_23LGNLLT4_1_trimmed_2																																																			90.0%	64%	116bp	117bp	18%	105.2M	90.0%	64%	116bp	117bp	18%	105.2M
tih_rna_sample_00341_23LGNLLT4_1	No	0.00%	572873878	0.01%	0.63%	213831183	0.72%	0.74%	0.26%	0.26%	153081201	77360635	55578166	26647601	273.23	121.00	0.71%	0.54%	0.98	0.000	135.0bp	128.0bp	0.13%	1.26%	0.36%	0.00%	0.27%	3.86%	0.57%	0.00%	9999000000	221852253				135bp	187bp	63.2%	0.0%	89.0%	82.6%	94.0%	269.1M	43.0%	97.6%	70349.2Mb	572.9M	56.6%	98.6%	63.8%
tih_rna_sample_00341_23LGNLLT4_1_1																																	135.0bp	88.8%	254.3M																78.3%	55%	151bp	151bp	27%	290.6M
tih_rna_sample_00341_23LGNLLT4_1_2																																																			77.6%	56%	151bp	151bp	18%	290.6M
tih_rna_sample_00341_23LGNLLT4_1_trimmed_1																																																			78.3%	56%	126bp	132bp	18%	286.4M	78.3%	56%	126bp	132bp	18%	286.4M
tih_rna_sample_00341_23LGNLLT4_1_trimmed_2																																																			78.3%	56%	126bp	132bp	9%	286.4M	78.3%	56%	126bp	132bp	9%	286.4M
tih_rna_sample_00344_23LGNLLT4_1	No	0.00%	419186438	0.01%	0.61%	161569727	0.69%	0.72%	0.28%	0.28%	112227713	56842032	45152694	21614612	201.78	90.00	0.66%	0.48%	0.98	0.000	139.3bp	131.0bp	0.06%	1.36%	0.52%	0.00%	0.12%	4.12%	0.78%	0.00%	9999000000	177491656				143bp	214bp	62.1%	0.0%	87.0%	85.0%	94.5%	198.0M	45.1%	97.7%	52411.6Mb	419.2M	53.9%	98.5%	60.5%
tih_rna_sample_00344_23LGNLLT4_1_1																																	139.3bp	87.3%	183.1M																76.9%	53%	151bp	151bp	27%	212.8M
tih_rna_sample_00344_23LGNLLT4_1_2																																																			75.7%	53%	151bp	151bp	18%	212.8M
tih_rna_sample_00344_23LGNLLT4_1_trimmed_1																																																			76.8%	53%	128bp	137bp	18%	209.6M	76.8%	53%	128bp	137bp	18%	209.6M
tih_rna_sample_00344_23LGNLLT4_1_trimmed_2																																																			76.3%	54%	128bp	137bp	9%	209.6M	76.3%	54%	128bp	137bp	9%	209.6M
tih_rna_sample_00345_23LGNLLT4_1	No	0.00%	592368300	0.01%	0.80%	121016423	0.76%	0.79%	0.21%	0.21%	91856676	46249026	25471551	12209662	145.80	50.00	0.58%	0.37%	0.98	0.000	123.6bp	117.0bp	0.15%	0.90%	0.67%	0.00%	0.34%	2.85%	1.01%	0.00%	9999000000	110771055				125bp	207bp	80.1%	0.0%	95.8%	84.8%	95.0%	281.3M	53.1%	97.8%	68893.0Mb	592.4M	54.8%	98.7%	74.1%
tih_rna_sample_00345_23LGNLLT4_1_1																																	123.6bp	95.1%	281.5M																87.3%	53%	151bp	151bp	27%	381.8M
tih_rna_sample_00345_23LGNLLT4_1_2																																																			86.0%	54%	151bp	151bp	27%	381.8M
tih_rna_sample_00345_23LGNLLT4_1_trimmed_1																																																			85.6%	54%	119bp	122bp	18%	296.2M	85.6%	54%	119bp	122bp	18%	296.2M
tih_rna_sample_00345_23LGNLLT4_1_trimmed_2																																																			84.9%	54%	119bp	122bp	9%	296.2M	84.9%	54%	119bp	122bp	9%	296.2M
tih_rna_sample_00346_23LGNLLT4_1	No	0.00%	194834164	0.01%	0.70%	58570737	0.68%	0.71%	0.29%	0.29%	39876178	19995709	16774122	8102910	58.10	22.00	0.44%	0.17%	0.97	0.000	116.4bp	112.0bp	0.11%	0.61%	0.20%	0.00%	0.22%	1.88%	0.32%	0.00%	9999000000	81123053				114bp	146bp	70.6%	0.0%	91.2%	83.3%	94.1%	91.7M	40.8%	97.3%	21652.6Mb	194.8M	55.8%	94.3%	79.0%
tih_rna_sample_00346_23LGNLLT4_1_1																																	116.4bp	90.9%	88.5M																76.1%	55%	151bp	151bp	45%	103.3M
tih_rna_sample_00346_23LGNLLT4_1_2																																																			74.3%	56%	151bp	151bp	45%	103.3M
tih_rna_sample_00346_23LGNLLT4_1_trimmed_1																																																			75.1%	55%	114bp	117bp	18%	97.4M	75.1%	55%	114bp	117bp	18%	97.4M
tih_rna_sample_00346_23LGNLLT4_1_trimmed_2																																																			74.4%	56%	114bp	117bp	9%	97.4M	74.4%	56%	114bp	117bp	9%	97.4M
tih_rna_sample_00347_23LGNLLT4_1	No	0.00%	594604426	0.01%	0.48%	309754073	0.84%	0.87%	0.14%	0.13%	261346661	132524549	44800444	20146723	516.66	280.00	0.77%	0.67%	0.98	0.000	149.1bp	138.0bp	0.11%	1.02%	0.49%	0.00%	0.23%	3.09%	0.72%	0.00%	9999000000	377392949				165bp	335bp	48.2%	0.0%	92.2%	87.9%	95.4%	283.7M	34.1%	97.7%	76410.5Mb	594.6M	54.7%	99.1%	52.8%
tih_rna_sample_00347_23LGNLLT4_1_1																																	149.1bp	92.3%	274.4M																81.7%	54%	151bp	151bp	27%	440.0M
tih_rna_sample_00347_23LGNLLT4_1_2																																																			80.2%	54%	151bp	151bp	18%	440.0M
tih_rna_sample_00347_23LGNLLT4_1_trimmed_1																																																			78.6%	54%	132bp	147bp	18%	297.3M	78.6%	54%	132bp	147bp	18%	297.3M
tih_rna_sample_00347_23LGNLLT4_1_trimmed_2																																																			77.5%	54%	132bp	147bp	9%	297.3M	77.5%	54%	132bp	147bp	9%	297.3M
tih_rna_sample_00348_23LGNLLT4_1	Yes	0.00%	593268476	0.01%	0.51%	292145501	0.84%	0.86%	0.15%	0.14%	245235074	124051217	43492972	19909370	468.66	200.00	0.73%	0.61%	0.98	0.000	141.9bp	132.0bp	0.21%	0.63%	0.41%	0.00%	0.44%	1.86%	0.60%	0.00%	9999000000	339700611				153bp	279bp	51.1%	0.0%	92.5%	88.1%	95.7%	283.8M	35.1%	97.7%	75000.7Mb	593.3M	56.1%	98.9%	57.7%
tih_rna_sample_00348_23LGNLLT4_1_1																																	141.9bp	92.6%	274.7M																81.0%	55%	151bp	151bp	27%	436.7M
tih_rna_sample_00348_23LGNLLT4_1_2																																																			80.8%	55%	151bp	151bp	18%	436.7M
tih_rna_sample_00348_23LGNLLT4_1_trimmed_1																																																			77.7%	55%	129bp	142bp	18%	296.6M	77.7%	55%	129bp	142bp	18%	296.6M
tih_rna_sample_00348_23LGNLLT4_1_trimmed_2																																																			78.3%	56%	129bp	142bp	9%	296.6M	78.3%	56%	129bp	142bp	9%	296.6M
tih_rna_sample_00354_23LGNLLT4_1	No	0.00%	376349784	0.02%	0.80%	76159647	0.51%	0.56%	0.41%	0.44%	39061628	19624844	31096092	15310362	54.48	20.00	0.42%	0.14%	0.97	0.000	111.0bp	107.0bp	0.10%	0.62%	0.29%	0.00%	0.25%	2.22%	0.52%	0.00%	9999000000	97945058				108bp	124bp	81.1%	0.0%	90.0%	61.3%	83.6%	157.4M	46.2%	97.2%	40334.8Mb	376.3M	56.8%	97.1%	83.8%
tih_rna_sample_00354_23LGNLLT4_1_1																																	111.0bp	89.0%	167.4M																83.0%	55%	151bp	151bp	36%	193.8M
tih_rna_sample_00354_23LGNLLT4_1_2																																																			81.9%	56%	151bp	151bp	45%	193.8M
tih_rna_sample_00354_23LGNLLT4_1_trimmed_1																																																			82.8%	56%	110bp	112bp	18%	188.2M	82.8%	56%	110bp	112bp	18%	188.2M
tih_rna_sample_00354_23LGNLLT4_1_trimmed_2																																																			82.4%	56%	110bp	112bp	9%	188.2M	82.4%	56%	110bp	112bp	9%	188.2M
tih_rna_sample_00355_23LGNLLT4_1	No	0.00%	593935642	0.01%	0.47%	312288301	0.84%	0.86%	0.15%	0.14%	262594261	132507844	45862264	21331680	478.40	258.00	0.76%	0.65%	0.98	0.000	133.9bp	127.0bp	0.27%	0.89%	0.56%	0.00%	0.58%	2.73%	0.80%	0.00%	9999000000	392070367				141bp	243bp	47.7%	0.0%	92.4%	87.1%	95.0%	282.1M	32.5%	97.7%	73086.2Mb	593.9M	54.3%	99.0%	64.2%
tih_rna_sample_00355_23LGNLLT4_1_1																																	133.9bp	92.6%	275.0M																80.3%	53%	151bp	151bp	27%	428.0M
tih_rna_sample_00355_23LGNLLT4_1_2																																																			79.8%	54%	151bp	151bp	18%	428.0M
tih_rna_sample_00355_23LGNLLT4_1_trimmed_1																																																			77.3%	54%	126bp	132bp	18%	297.0M	77.3%	54%	126bp	132bp	18%	297.0M
tih_rna_sample_00355_23LGNLLT4_1_trimmed_2																																																			77.4%	54%	126bp	132bp	9%	297.0M	77.4%	54%	126bp	132bp	9%	297.0M
tih_rna_sample_00357_23LGNLLT4_1	No	0.00%	591278824	0.01%	0.46%	319653954	0.89%	0.91%	0.10%	0.09%	283900032	142812434	32202387	14338072	510.58	221.00	0.70%	0.60%	0.97	0.000	129.1bp	121.0bp	0.05%	0.27%	0.33%	0.00%	0.12%	0.92%	0.50%	0.00%	9999000000	494574153				136bp	246bp	46.2%	0.0%	95.2%	89.8%	96.0%	283.7M	23.8%	97.2%	70389.1Mb	591.3M	55.4%	98.5%	68.0%
tih_rna_sample_00357_23LGNLLT4_1_1																																	129.1bp	95.5%	282.3M																78.8%	54%	151bp	151bp	27%	355.2M
tih_rna_sample_00357_23LGNLLT4_1_2																																																			77.7%	55%	151bp	151bp	18%	355.2M
tih_rna_sample_00357_23LGNLLT4_1_trimmed_1																																																			77.5%	55%	122bp	127bp	27%	295.6M	77.5%	55%	122bp	127bp	27%	295.6M
tih_rna_sample_00357_23LGNLLT4_1_trimmed_2																																																			77.2%	55%	123bp	127bp	18%	295.6M	77.2%	55%	123bp	127bp	18%	295.6M
tih_rna_sample_00358_23LGNLLT4_1	No	0.00%	563393476	0.01%	0.64%	202406289	0.72%	0.74%	0.26%	0.26%	145102321	73011659	51891771	25221704	227.21	103.00	0.67%	0.51%	0.98	0.000	119.1bp	113.0bp	0.15%	0.83%	0.49%	0.00%	0.34%	2.55%	0.74%	0.00%	9999000000	211597799				118bp	156bp	64.7%	0.0%	90.0%	83.8%	94.2%	265.3M	39.7%	97.8%	64287.4Mb	563.4M	54.3%	98.8%	77.2%
tih_rna_sample_00358_23LGNLLT4_1_1																																	119.1bp	89.8%	253.1M																76.6%	53%	151bp	151bp	27%	285.2M
tih_rna_sample_00358_23LGNLLT4_1_2																																																			75.0%	53%	151bp	151bp	27%	285.2M
tih_rna_sample_00358_23LGNLLT4_1_trimmed_1																																																			76.6%	54%	117bp	117bp	18%	281.7M	76.6%	54%	117bp	117bp	18%	281.7M
tih_rna_sample_00358_23LGNLLT4_1_trimmed_2																																																			75.6%	54%	117bp	117bp	9%	281.7M	75.6%	54%	117bp	117bp	9%	281.7M
tih_rna_sample_00360_23LGNLLT4_1	No	0.00%	425118090	0.01%	0.81%	81502656	0.62%	0.66%	0.34%	0.34%	50126633	25542207	27762313	13176215	99.98	43.00	0.57%	0.29%	0.98	0.000	161.2bp	149.0bp	0.11%	0.45%	0.38%	0.00%	0.23%	1.53%	0.60%	0.00%	9999000000	85131825				191bp	390bp	81.5%	0.0%	91.1%	88.2%	95.5%	203.0M	64.5%	97.6%	56531.9Mb	425.1M	55.3%	97.9%	44.5%
tih_rna_sample_00360_23LGNLLT4_1_1																																	161.2bp	91.4%	194.2M																85.6%	55%	151bp	151bp	36%	217.2M
tih_rna_sample_00360_23LGNLLT4_1_2																																																			84.1%	55%	151bp	151bp	18%	217.2M
tih_rna_sample_00360_23LGNLLT4_1_trimmed_1																																																			85.5%	55%	136bp	151bp	27%	212.6M	85.5%	55%	136bp	151bp	27%	212.6M
tih_rna_sample_00360_23LGNLLT4_1_trimmed_2																																																			84.9%	55%	136bp	151bp	9%	212.6M	84.9%	55%	136bp	151bp	9%	212.6M
tih_rna_sample_00375_23LGNLLT4_1	No	0.00%	537435734	0.01%	0.67%	179179756	0.83%	0.85%	0.16%	0.15%	148159756	74586327	27908978	12847425	261.19	122.00	0.69%	0.54%	0.97	0.000	129.2bp	121.0bp	0.16%	0.28%	0.22%	0.00%	0.38%	1.00%	0.37%	0.00%	9999000000	205401895				152bp	328bp	67.0%	0.0%	94.6%	89.9%	95.9%	257.8M	43.3%	97.3%	64087.1Mb	537.4M	55.2%	98.1%	67.7%
tih_rna_sample_00375_23LGNLLT4_1_1																																	129.2bp	95.2%	255.8M																82.8%	54%	151bp	151bp	27%	273.8M
tih_rna_sample_00375_23LGNLLT4_1_2																																																			81.8%	54%	151bp	151bp	18%	273.8M
tih_rna_sample_00375_23LGNLLT4_1_trimmed_1																																																			82.7%	54%	122bp	127bp	18%	268.7M	82.7%	54%	122bp	127bp	18%	268.7M
tih_rna_sample_00375_23LGNLLT4_1_trimmed_2																																																			82.8%	55%	123bp	127bp	18%	268.7M	82.8%	55%	123bp	127bp	18%	268.7M
tih_rna_sample_00401_23LGNLLT4_1	No	0.00%	393034312	0.02%	0.63%	146168069	0.80%	0.85%	0.15%	0.15%	117311603	58789200	21298396	10067768	156.70	56.00	0.60%	0.38%	0.97	0.000	95.7bp	91.0bp	0.79%	0.72%	0.27%	0.00%	1.61%	2.01%	0.40%	0.00%	9999000000	172910142				87bp	106bp	64.0%	0.0%	90.2%	40.9%	79.2%	155.6M	22.8%	97.2%	35093.8Mb	393.0M	57.7%	98.4%	91.2%
tih_rna_sample_00401_23LGNLLT4_1_1																																	95.7bp	83.7%	164.4M																81.2%	55%	151bp	151bp	27%	199.8M
tih_rna_sample_00401_23LGNLLT4_1_2																																																			79.2%	57%	151bp	151bp	36%	199.8M
tih_rna_sample_00401_23LGNLLT4_1_trimmed_1																																																			81.2%	57%	92bp	92bp	18%	196.5M	81.2%	57%	92bp	92bp	18%	196.5M
tih_rna_sample_00401_23LGNLLT4_1_trimmed_2																																																			79.9%	57%	92bp	92bp	9%	196.5M	79.9%	57%	92bp	92bp	9%	196.5M
tih_rna_sample_00417_23LGNLLT4_1	No	0.00%	361271620	0.01%	0.69%	112200838	0.77%	0.80%	0.21%	0.20%	86010809	43287802	23708047	11084611	155.46	72.00	0.65%	0.42%	0.97	0.000	137.3bp	129.0bp	0.08%	0.31%	0.16%	0.00%	0.16%	1.11%	0.27%	0.00%	9999000000	141594693				161bp	318bp	69.4%	0.0%	92.8%	87.8%	95.4%	172.3M	48.2%	97.1%	44523.9Mb	361.3M	55.7%	96.9%	61.8%
tih_rna_sample_00417_23LGNLLT4_1_1																																	137.3bp	93.5%	168.9M																81.4%	55%	151bp	151bp	45%	186.4M
tih_rna_sample_00417_23LGNLLT4_1_2																																																			79.9%	55%	151bp	151bp	36%	186.4M
tih_rna_sample_00417_23LGNLLT4_1_trimmed_1																																																			81.1%	55%	127bp	137bp	27%	180.6M	81.1%	55%	127bp	137bp	27%	180.6M
tih_rna_sample_00417_23LGNLLT4_1_trimmed_2																																																			80.9%	55%	127bp	137bp	18%	180.6M	80.9%	55%	127bp	137bp	18%	180.6M
tih_rna_sample_00423_23LGNLLT4_1	Yes	0.00%	446184114	0.01%	0.55%	200471106	0.84%	0.87%	0.14%	0.13%	168119119	84857329	28682992	12876029	316.82	138.00	0.69%	0.55%	0.97	0.000	143.5bp	134.0bp	0.21%	0.71%	0.20%	0.00%	0.45%	2.23%	0.33%	0.00%	9999000000	230420073				147bp	234bp	55.5%	0.0%	92.7%	78.6%	92.7%	206.8M	36.7%	97.2%	56071.0Mb	446.2M	57.5%	98.0%	57.6%
tih_rna_sample_00423_23LGNLLT4_1_1																																	143.5bp	93.1%	207.7M																79.1%	56%	151bp	151bp	27%	227.7M
tih_rna_sample_00423_23LGNLLT4_1_2																																																			78.3%	57%	151bp	151bp	18%	227.7M
tih_rna_sample_00423_23LGNLLT4_1_trimmed_1																																																			79.1%	57%	129bp	142bp	18%	223.1M	79.1%	57%	129bp	142bp	18%	223.1M
tih_rna_sample_00423_23LGNLLT4_1_trimmed_2																																																			79.4%	57%	129bp	142bp	9%	223.1M	79.4%	57%	129bp	142bp	9%	223.1M
tih_rna_sample_00452_23LGNLLT4_1	No	0.00%	594739138	0.01%	0.43%	340588362	0.82%	0.84%	0.17%	0.16%	279888590	141354153	57253850	26840906	505.43	231.00	0.73%	0.61%	0.98	0.000	131.4bp	123.0bp	0.34%	0.76%	0.53%	0.00%	0.70%	2.22%	0.73%	0.00%	9999000000	528057838				136bp	231bp	43.0%	0.0%	90.8%	88.0%	95.5%	284.0M	27.8%	97.8%	72363.3Mb	594.7M	52.4%	99.1%	65.4%
tih_rna_sample_00452_23LGNLLT4_1_1																																	131.4bp	91.0%	270.5M																81.0%	51%	151bp	151bp	27%	540.6M
tih_rna_sample_00452_23LGNLLT4_1_2																																																			80.4%	52%	151bp	151bp	18%	540.6M
tih_rna_sample_00452_23LGNLLT4_1_trimmed_1																																																			76.7%	52%	124bp	132bp	18%	297.4M	76.7%	52%	124bp	132bp	18%	297.4M
tih_rna_sample_00452_23LGNLLT4_1_trimmed_2																																																			76.6%	52%	124bp	132bp	9%	297.4M	76.6%	52%	124bp	132bp	9%	297.4M
tih_rna_sample_00477_23LGNLLT4_1	No	0.00%	594701142	0.00%	0.47%	314470007	0.86%	0.88%	0.14%	0.12%	268934947	136209743	42701937	19206756	532.34	246.00	0.73%	0.62%	0.98	0.000	147.8bp	137.0bp	0.23%	1.25%	0.54%	0.00%	0.49%	3.71%	0.80%	0.00%	9999000000	404023465				170bp	373bp	47.3%	0.0%	92.9%	90.1%	96.3%	286.2M	32.7%	97.8%	76591.2Mb	594.7M	53.8%	99.1%	53.3%
tih_rna_sample_00477_23LGNLLT4_1_1																																	147.8bp	93.2%	277.1M																82.6%	53%	151bp	151bp	27%	508.9M
tih_rna_sample_00477_23LGNLLT4_1_2																																																			81.5%	53%	151bp	151bp	18%	508.9M
tih_rna_sample_00477_23LGNLLT4_1_trimmed_1																																																			78.5%	53%	132bp	147bp	18%	297.4M	78.5%	53%	132bp	147bp	18%	297.4M
tih_rna_sample_00477_23LGNLLT4_1_trimmed_2																																																			78.0%	54%	132bp	147bp	9%	297.4M	78.0%	54%	132bp	147bp	9%	297.4M
tih_rna_sample_00483_23LGNLLT4_1	No	0.00%	591645478	0.01%	0.69%	184969377	0.74%	0.78%	0.23%	0.22%	137327267	69666420	42245862	19759712	261.65	129.00	0.71%	0.55%	0.98	0.000	149.4bp	139.0bp	0.10%	0.82%	0.38%	0.00%	0.20%	2.44%	0.57%	0.00%	9999000000	176583417				156bp	262bp	69.4%	0.0%	90.8%	84.1%	94.1%	278.4M	51.1%	97.5%	76143.5Mb	591.6M	55.6%	98.6%	53.5%
tih_rna_sample_00483_23LGNLLT4_1_1																																	149.4bp	90.5%	267.7M																81.2%	55%	151bp	151bp	27%	302.2M
tih_rna_sample_00483_23LGNLLT4_1_2																																																			79.9%	55%	151bp	151bp	18%	302.2M
tih_rna_sample_00483_23LGNLLT4_1_trimmed_1																																																			81.2%	55%	132bp	147bp	18%	295.8M	81.2%	55%	132bp	147bp	18%	295.8M
tih_rna_sample_00483_23LGNLLT4_1_trimmed_2																																																			80.7%	55%	132bp	147bp	9%	295.8M	80.7%	55%	132bp	147bp	9%	295.8M
tih_rna_sample_00485_23LGNLLT4_1	No	0.00%	594598496	0.01%	0.47%	317379618	0.84%	0.87%	0.14%	0.13%	265644289	134320144	45238795	20728755	516.46	264.00	0.78%	0.67%	0.98	0.000	143.2bp	133.0bp	0.18%	0.67%	0.40%	0.00%	0.40%	2.17%	0.60%	0.00%	9999000000	430198067				150bp	261bp	47.1%	0.0%	92.0%	85.8%	93.8%	278.9M	31.4%	97.8%	75546.9Mb	594.6M	54.3%	99.1%	56.4%
tih_rna_sample_00485_23LGNLLT4_1_1																																	143.2bp	92.4%	274.6M																81.3%	53%	151bp	151bp	27%	476.2M
tih_rna_sample_00485_23LGNLLT4_1_2																																																			80.9%	54%	151bp	151bp	18%	476.2M
tih_rna_sample_00485_23LGNLLT4_1_trimmed_1																																																			77.7%	54%	130bp	142bp	27%	297.3M	77.7%	54%	130bp	142bp	27%	297.3M
tih_rna_sample_00485_23LGNLLT4_1_trimmed_2																																																			77.9%	54%	130bp	142bp	9%	297.3M	77.9%	54%	130bp	142bp	9%	297.3M
tih_rna_sample_00487_23LGNLLT4_1	No	0.00%	297590786	0.01%	0.80%	58175324	0.51%	0.56%	0.42%	0.44%	29731576	15029830	24638756	12037993	50.10	20.00	0.41%	0.12%	0.98	0.000	133.0bp	127.0bp	0.74%	0.64%	0.34%	0.00%	1.50%	1.96%	0.53%	0.00%	9990000000	64746234				137bp	195bp	81.5%	0.0%	88.0%	76.7%	92.2%	137.3M	58.0%	97.4%	36370.0Mb	297.6M	56.9%	97.2%	64.4%
tih_rna_sample_00487_23LGNLLT4_1_1																																	133.0bp	87.5%	130.2M																83.7%	56%	151bp	151bp	27%	153.1M
tih_rna_sample_00487_23LGNLLT4_1_2																																																			82.3%	56%	151bp	151bp	27%	153.1M
tih_rna_sample_00487_23LGNLLT4_1_trimmed_1																																																			83.6%	56%	125bp	132bp	18%	148.8M	83.6%	56%	125bp	132bp	18%	148.8M
tih_rna_sample_00487_23LGNLLT4_1_trimmed_2																																																			82.9%	57%	126bp	132bp	9%	148.8M	82.9%	57%	126bp	132bp	9%	148.8M
tih_rna_sample_00494_23LGNLLT4_1	No	0.00%	447300618	0.01%	0.78%	96732825	0.56%	0.59%	0.40%	0.41%	54090880	27274749	38621474	18890134	87.32	38.00	0.55%	0.26%	0.98	0.000	125.8bp	120.0bp	0.12%	0.75%	0.44%	0.00%	0.24%	2.38%	0.67%	0.00%	9999000000	107037004				126bp	173bp	79.1%	0.0%	89.4%	82.0%	94.0%	210.3M	53.8%	97.6%	52725.7Mb	447.3M	56.2%	98.3%	72.0%
tih_rna_sample_00494_23LGNLLT4_1_1																																	125.8bp	89.0%	199.0M																82.7%	55%	151bp	151bp	27%	227.6M
tih_rna_sample_00494_23LGNLLT4_1_2																																																			81.5%	56%	151bp	151bp	27%	227.6M
tih_rna_sample_00494_23LGNLLT4_1_trimmed_1																																																			82.7%	56%	121bp	122bp	18%	223.7M	82.7%	56%	121bp	122bp	18%	223.7M
tih_rna_sample_00494_23LGNLLT4_1_trimmed_2																																																			82.2%	56%	121bp	127bp	9%	223.7M	82.2%	56%	121bp	127bp	9%	223.7M
tih_rna_sample_00499_23LGNLLT4_1	Yes	0.00%	594843000	0.00%	0.38%	368028495	0.84%	0.87%	0.15%	0.13%	310687271	157943866	54552450	24165821	672.68	359.00	0.77%	0.68%	0.98	0.000	167.9bp	154.0bp	0.16%	0.64%	0.34%	0.00%	0.35%	2.08%	0.50%	0.00%	9999000000	581772664				190bp	388bp	38.3%	0.0%	90.4%	90.3%	96.1%	285.9M	29.4%	97.8%	80119.3Mb	594.8M	53.6%	99.1%	39.7%
tih_rna_sample_00499_23LGNLLT4_1_1																																	167.9bp	91.1%	270.9M																82.3%	53%	151bp	151bp	27%	663.3M
tih_rna_sample_00499_23LGNLLT4_1_2																																																			81.9%	53%	151bp	151bp	18%	663.3M
tih_rna_sample_00499_23LGNLLT4_1_trimmed_1																																																			76.4%	53%	138bp	151bp	18%	297.4M	76.4%	53%	138bp	151bp	18%	297.4M
tih_rna_sample_00499_23LGNLLT4_1_trimmed_2																																																			76.6%	53%	138bp	151bp	9%	297.4M	76.6%	53%	138bp	151bp	9%	297.4M
tih_rna_sample_00500_23LGNLLT4_1	No	0.00%	594592380	0.01%	0.46%	323355866	0.85%	0.87%	0.14%	0.13%	274065753	138699396	46137772	21009705	536.56	275.00	0.76%	0.65%	0.98	0.000	147.2bp	138.0bp	0.11%	0.81%	0.39%	0.00%	0.23%	2.53%	0.59%	0.00%	9999000000	423106179				165bp	328bp	45.9%	0.0%	92.1%	89.0%	95.8%	284.8M	33.9%	97.8%	76357.5Mb	594.6M	54.1%	99.1%	53.9%
tih_rna_sample_00500_23LGNLLT4_1_1																																	147.2bp	92.5%	274.9M																82.6%	53%	151bp	151bp	27%	595.5M
tih_rna_sample_00500_23LGNLLT4_1_2																																																			81.9%	54%	151bp	151bp	18%	595.5M
tih_rna_sample_00500_23LGNLLT4_1_trimmed_1																																																			77.1%	53%	131bp	147bp	18%	297.3M	77.1%	53%	131bp	147bp	18%	297.3M
tih_rna_sample_00500_23LGNLLT4_1_trimmed_2																																																			77.0%	54%	131bp	147bp	9%	297.3M	77.0%	54%	131bp	147bp	9%	297.3M
tih_rna_sample_00501_23LGNLLT4_1	No	0.00%	592961230	0.01%	0.49%	305215832	0.87%	0.90%	0.12%	0.10%	265837605	134686319	35103392	15293960	528.23	238.00	0.75%	0.64%	0.98	0.000	152.5bp	141.0bp	0.20%	0.51%	0.23%	0.00%	0.41%	1.58%	0.37%	0.00%	9999000000	350839754				162bp	268bp	48.9%	0.0%	93.1%	84.7%	94.6%	280.5M	35.5%	97.6%	76900.2Mb	593.0M	57.8%	98.8%	50.1%
tih_rna_sample_00501_23LGNLLT4_1_1																																	152.5bp	93.8%	278.0M																84.3%	56%	151bp	151bp	27%	548.2M
tih_rna_sample_00501_23LGNLLT4_1_2																																																			83.8%	57%	151bp	151bp	18%	548.2M
tih_rna_sample_00501_23LGNLLT4_1_trimmed_1																																																			79.4%	57%	133bp	151bp	18%	296.5M	79.4%	57%	133bp	151bp	18%	296.5M
tih_rna_sample_00501_23LGNLLT4_1_trimmed_2																																																			79.9%	57%	133bp	151bp	9%	296.5M	79.9%	57%	133bp	151bp	9%	296.5M
tih_rna_sample_00505_23LGNLLT4_1	No	0.00%	369561866	0.01%	0.69%	113184834	0.54%	0.56%	0.43%	0.44%	61210397	30768737	48261216	23804471	84.83	39.00	0.55%	0.26%	0.98	0.000	107.8bp	104.0bp	0.33%	0.77%	0.44%	0.00%	0.67%	2.32%	0.64%	0.00%	9999000000	140526989				106bp	129bp	70.1%	0.0%	85.5%	81.4%	93.7%	173.1M	38.9%	97.6%	38959.4Mb	369.6M	53.1%	97.5%	85.2%
tih_rna_sample_00505_23LGNLLT4_1_1																																	107.8bp	85.1%	157.2M																76.5%	52%	151bp	151bp	27%	189.5M
tih_rna_sample_00505_23LGNLLT4_1_2																																																			75.2%	53%	151bp	151bp	45%	189.5M
tih_rna_sample_00505_23LGNLLT4_1_trimmed_1																																																			76.2%	53%	108bp	107bp	18%	184.8M	76.2%	53%	108bp	107bp	18%	184.8M
tih_rna_sample_00505_23LGNLLT4_1_trimmed_2																																																			75.5%	53%	108bp	107bp	9%	184.8M	75.5%	53%	108bp	107bp	9%	184.8M
tih_rna_sample_00508_23LGNLLT4_1	No	0.00%	593810500	0.01%	0.65%	208299642	0.78%	0.81%	0.20%	0.19%	163266454	82744929	41235604	19198670	303.82	148.00	0.72%	0.57%	0.98	0.000	141.5bp	132.0bp	0.20%	0.49%	0.36%	0.00%	0.46%	1.64%	0.57%	0.00%	9999000000	208484739				155bp	291bp	65.3%	0.0%	92.0%	88.3%	95.8%	284.3M	48.3%	97.6%	74640.5Mb	593.8M	55.7%	99.0%	58.7%
tih_rna_sample_00508_23LGNLLT4_1_1																																	141.5bp	92.4%	274.4M																83.8%	54%	151bp	151bp	27%	363.7M
tih_rna_sample_00508_23LGNLLT4_1_2																																																			82.1%	55%	151bp	151bp	18%	363.7M
tih_rna_sample_00508_23LGNLLT4_1_trimmed_1																																																			82.3%	55%	129bp	137bp	18%	296.9M	82.3%	55%	129bp	137bp	18%	296.9M
tih_rna_sample_00508_23LGNLLT4_1_trimmed_2																																																			81.1%	55%	129bp	137bp	9%	296.9M	81.1%	55%	129bp	137bp	9%	296.9M
tih_rna_sample_00509_23LGNLLT4_1	Yes	0.00%	594389346	0.01%	0.42%	347697530	0.85%	0.87%	0.15%	0.13%	293980764	149127310	50547749	22682374	611.56	315.00	0.76%	0.67%	0.98	0.000	160.1bp	147.0bp	0.10%	0.67%	0.33%	0.00%	0.22%	2.17%	0.50%	0.00%	9999000000	514188442				179bp	350bp	41.7%	0.0%	91.3%	89.2%	95.9%	284.9M	29.6%	97.7%	78284.4Mb	594.4M	54.4%	99.1%	45.8%
tih_rna_sample_00509_23LGNLLT4_1_1																																	160.1bp	91.7%	272.5M																80.2%	53%	151bp	151bp	27%	526.9M
tih_rna_sample_00509_23LGNLLT4_1_2																																																			80.0%	54%	151bp	151bp	18%	526.9M
tih_rna_sample_00509_23LGNLLT4_1_trimmed_1																																																			75.7%	54%	135bp	151bp	18%	297.2M	75.7%	54%	135bp	151bp	18%	297.2M
tih_rna_sample_00509_23LGNLLT4_1_trimmed_2																																																			76.1%	54%	135bp	151bp	9%	297.2M	76.1%	54%	135bp	151bp	9%	297.2M
tih_rna_sample_00510_23LGNLLT4_1	No	0.00%	346685302	0.01%	0.74%	88654043	0.50%	0.53%	0.46%	0.47%	44240500	22358896	40861839	20049482	69.55	25.00	0.47%	0.19%	0.98	0.000	126.6bp	120.0bp	0.30%	0.29%	0.24%	0.00%	0.69%	0.86%	0.33%	0.00%	9999000000	122512031				125bp	164bp	75.2%	0.0%	85.1%	80.9%	93.6%	162.3M	50.3%	97.4%	41078.7Mb	346.7M	53.8%	98.5%	71.3%
tih_rna_sample_00510_23LGNLLT4_1_1																																	126.6bp	85.2%	147.7M																79.6%	53%	151bp	151bp	27%	176.0M
tih_rna_sample_00510_23LGNLLT4_1_2																																																			78.2%	53%	151bp	151bp	27%	176.0M
tih_rna_sample_00510_23LGNLLT4_1_trimmed_1																																																			79.5%	53%	122bp	127bp	18%	173.3M	79.5%	53%	122bp	127bp	18%	173.3M
tih_rna_sample_00510_23LGNLLT4_1_trimmed_2																																																			78.7%	53%	122bp	127bp	18%	173.3M	78.7%	53%	122bp	127bp	18%	173.3M
tih_rna_sample_00512_23LGNLLT4_1	No	0.00%	595228266	0.01%	0.57%	254041803	0.84%	0.86%	0.15%	0.14%	212350243	107288982	38318459	17745285	395.00	182.00	0.74%	0.61%	0.98	0.000	135.3bp	128.0bp	0.09%	0.71%	0.50%	0.00%	0.19%	2.43%	0.79%	0.00%	9999000000	291714707				166bp	366bp	57.6%	0.0%	93.5%	90.1%	96.3%	286.6M	39.0%	97.7%	74093.9Mb	595.2M	55.0%	99.2%	61.6%
tih_rna_sample_00512_23LGNLLT4_1_1																																	135.3bp	93.6%	278.6M																83.2%	54%	151bp	151bp	27%	465.2M
tih_rna_sample_00512_23LGNLLT4_1_2																																																			82.3%	54%	151bp	151bp	18%	465.2M
tih_rna_sample_00512_23LGNLLT4_1_trimmed_1																																																			79.7%	54%	127bp	137bp	18%	297.6M	79.7%	54%	127bp	137bp	18%	297.6M
tih_rna_sample_00512_23LGNLLT4_1_trimmed_2																																																			79.2%	55%	127bp	137bp	9%	297.6M	79.2%	55%	127bp	137bp	9%	297.6M
tih_rna_sample_00528_23LGNLLT4_1	Yes	0.31%	564497636	0.01%	0.73%	153901106	0.63%	0.65%	0.34%	0.35%	96519037	48763475	53060641	25792319	150.17	74.00	0.66%	0.43%	0.98	0.000	125.0bp	118.0bp	0.15%	0.88%	0.35%	0.00%	0.30%	2.65%	0.54%	0.00%	9999000000	155037836				124bp	171bp	73.3%	0.0%	88.3%	83.1%	94.1%	265.7M	53.7%	97.7%	65985.2Mb	564.5M	56.2%	98.7%	73.0%
tih_rna_sample_00528_23LGNLLT4_1_1																																	125.0bp	88.5%	249.7M																81.4%	55%	151bp	151bp	27%	285.9M
tih_rna_sample_00528_23LGNLLT4_1_2																																																			79.9%	55%	151bp	151bp	18%	285.9M
tih_rna_sample_00528_23LGNLLT4_1_trimmed_1																																																			81.4%	56%	120bp	122bp	18%	282.2M	81.4%	56%	120bp	122bp	18%	282.2M
tih_rna_sample_00528_23LGNLLT4_1_trimmed_2																																																			80.5%	56%	120bp	122bp	9%	282.2M	80.5%	56%	120bp	122bp	9%	282.2M
tih_rna_sample_00531_23LGNLLT4_1	No	0.00%	54800140	0.01%	0.72%	15610370	0.43%	0.46%	0.52%	0.54%	6770042	3402964	8080491	3994691	9.10	4.00	0.05%	0.01%	0.98	0.000	109.3bp	106.0bp	0.13%	0.61%	0.39%	0.00%	0.27%	1.93%	0.60%	0.00%	9999000000	20681991				109bp	138bp	72.5%	0.0%	82.1%	70.9%	91.5%	25.1M	42.8%	97.6%	5775.2Mb	54.8M	54.8%	90.5%	82.2%
tih_rna_sample_00531_23LGNLLT4_1_1																																	109.3bp	80.7%	22.1M																74.9%	56%	151bp	151bp	45%	30.3M
tih_rna_sample_00531_23LGNLLT4_1_2																																																			73.6%	58%	151bp	151bp	55%	30.3M
tih_rna_sample_00531_23LGNLLT4_1_trimmed_1																																																			72.5%	54%	108bp	107bp	18%	27.4M	72.5%	54%	108bp	107bp	18%	27.4M
tih_rna_sample_00531_23LGNLLT4_1_trimmed_2																																																			71.9%	54%	108bp	107bp	9%	27.4M	71.9%	54%	108bp	107bp	9%	27.4M
tih_rna_sample_00535_23LGNLLT4_1	No	0.00%	156383120	0.01%	0.78%	33924673	0.53%	0.57%	0.41%	0.43%	18086935	9100402	13750438	6761352	25.00	10.00	0.24%	0.04%	0.98	0.000	110.9bp	107.0bp	0.54%	1.25%	0.49%	0.00%	1.10%	3.69%	0.76%	0.00%	9999000000	37309722				109bp	134bp	79.4%	0.0%	89.6%	75.3%	92.1%	72.0M	48.0%	97.6%	16781.2Mb	156.4M	55.9%	95.7%	81.8%
tih_rna_sample_00535_23LGNLLT4_1_1																																	110.9bp	87.8%	68.7M																80.2%	55%	151bp	151bp	45%	81.7M
tih_rna_sample_00535_23LGNLLT4_1_2																																																			78.8%	57%	151bp	151bp	45%	81.7M
tih_rna_sample_00535_23LGNLLT4_1_trimmed_1																																																			79.6%	55%	110bp	112bp	18%	78.2M	79.6%	55%	110bp	112bp	18%	78.2M
tih_rna_sample_00535_23LGNLLT4_1_trimmed_2																																																			79.0%	56%	110bp	112bp	9%	78.2M	79.0%	56%	110bp	112bp	9%	78.2M
tih_rna_sample_00536_23LGNLLT4_1	No	0.00%	46561884	0.04%	0.80%	9093488	0.32%	0.40%	0.48%	0.60%	2864971	1436329	4338381	2118968	3.72	1.00	0.01%	0.00%	0.97	0.000	95.6bp	94.0bp	0.82%	1.29%	0.50%	0.00%	1.61%	3.48%	0.66%	0.00%	9999000000	9565240				75bp	79bp	83.9%	1.3%	46.5%	7.7%	38.3%	8.9M	43.4%	96.1%	3570.7Mb	46.6M	60.1%	92.2%	89.7%
tih_rna_sample_00536_23LGNLLT4_1_1																																	95.6bp	37.2%	8.7M																84.0%	60%	151bp	151bp	45%	25.2M
tih_rna_sample_00536_23LGNLLT4_1_2																																																			81.7%	62%	151bp	151bp	55%	25.2M
tih_rna_sample_00536_23LGNLLT4_1_trimmed_1																																																			83.5%	59%	79bp	82bp	27%	23.3M	83.5%	59%	79bp	82bp	27%	23.3M
tih_rna_sample_00536_23LGNLLT4_1_trimmed_2																																																			82.9%	60%	80bp	82bp	27%	23.3M	82.9%	60%	80bp	82bp	27%	23.3M
tih_rna_sample_00543_23LGNLLT4_1	No	0.00%	276500442	0.01%	0.75%	70485502	0.46%	0.48%	0.50%	0.52%	32149792	16167815	35191023	17396512	44.59	18.00	0.39%	0.11%	0.98	0.000	112.6bp	109.0bp	0.24%	0.58%	0.42%	0.00%	0.53%	1.80%	0.63%	0.00%	9999000000	84421086				113bp	140bp	75.4%	0.0%	84.6%	81.0%	93.4%	129.2M	49.0%	97.7%	30385.6Mb	276.5M	53.1%	98.1%	83.2%
tih_rna_sample_00543_23LGNLLT4_1_1																																	112.6bp	84.5%	116.9M																78.3%	52%	151bp	151bp	27%	141.0M
tih_rna_sample_00543_23LGNLLT4_1_2																																																			77.0%	53%	151bp	151bp	45%	141.0M
tih_rna_sample_00543_23LGNLLT4_1_trimmed_1																																																			78.1%	53%	112bp	112bp	18%	138.3M	78.1%	53%	112bp	112bp	18%	138.3M
tih_rna_sample_00543_23LGNLLT4_1_trimmed_2																																																			77.5%	53%	113bp	112bp	9%	138.3M	77.5%	53%	113bp	112bp	9%	138.3M
tih_rna_sample_00548_23LGNLLT4_1	Yes	9.83%	373568566	0.01%	0.64%	133503718	0.63%	0.66%	0.34%	0.34%	84518865	42606865	45730482	22340090	131.61	59.00	0.61%	0.38%	0.98	0.000	118.1bp	112.0bp	0.52%	1.23%	0.53%	0.00%	1.00%	3.56%	0.73%	0.00%	9999000000	153888090				115bp	151bp	64.8%	0.0%	86.6%	83.5%	94.4%	176.3M	42.7%	97.8%	42138.2Mb	373.6M	53.3%	98.6%	77.5%
tih_rna_sample_00548_23LGNLLT4_1_1																																	118.1bp	86.4%	161.4M																76.9%	52%	151bp	151bp	27%	189.5M
tih_rna_sample_00548_23LGNLLT4_1_2																																																			75.1%	53%	151bp	151bp	27%	189.5M
tih_rna_sample_00548_23LGNLLT4_1_trimmed_1																																																			76.9%	53%	115bp	117bp	18%	186.8M	76.9%	53%	115bp	117bp	18%	186.8M
tih_rna_sample_00548_23LGNLLT4_1_trimmed_2																																																			75.6%	53%	115bp	117bp	9%	186.8M	75.6%	53%	115bp	117bp	9%	186.8M
tih_rna_sample_00549_23LGNLLT4_1	No	0.00%	591537600	0.01%	0.68%	189482362	0.77%	0.80%	0.20%	0.20%	145411492	73271947	38695628	18461250	233.93	87.00	0.67%	0.47%	0.98	0.000	122.0bp	115.0bp	0.10%	0.67%	0.49%	0.00%	0.19%	1.94%	0.69%	0.00%	9999000000	187578142				124bp	189bp	68.6%	0.0%	92.8%	83.9%	94.3%	278.9M	46.4%	97.6%	68429.5Mb	591.5M	58.5%	98.6%	74.5%
tih_rna_sample_00549_23LGNLLT4_1_1																																	122.0bp	92.5%	273.6M																85.1%	56%	151bp	151bp	27%	375.2M
tih_rna_sample_00549_23LGNLLT4_1_2																																																			83.7%	57%	151bp	151bp	18%	375.2M
tih_rna_sample_00549_23LGNLLT4_1_trimmed_1																																																			83.5%	58%	118bp	122bp	18%	295.8M	83.5%	58%	118bp	122bp	18%	295.8M
tih_rna_sample_00549_23LGNLLT4_1_trimmed_2																																																			82.9%	58%	119bp	122bp	9%	295.8M	82.9%	58%	119bp	122bp	9%	295.8M
tih_rna_sample_00566_23LGNLLT4_1	No	0.00%	593868858	0.01%	0.48%	309573013	0.87%	0.89%	0.12%	0.11%	268802294	136001033	37616177	16784092	529.22	251.00	0.74%	0.64%	0.98	0.000	147.0bp	136.0bp	0.23%	1.29%	0.57%	0.00%	0.46%	4.04%	0.85%	0.00%	9999000000	380591261				168bp	352bp	48.1%	0.0%	93.6%	88.6%	95.7%	284.2M	34.3%	97.7%	76190.5Mb	593.9M	54.2%	99.0%	54.0%
tih_rna_sample_00566_23LGNLLT4_1_1																																	147.0bp	93.7%	278.1M																82.9%	53%	151bp	151bp	27%	490.1M
tih_rna_sample_00566_23LGNLLT4_1_2																																																			82.6%	54%	151bp	151bp	18%	490.1M
tih_rna_sample_00566_23LGNLLT4_1_trimmed_1																																																			79.0%	54%	131bp	147bp	18%	296.9M	79.0%	54%	131bp	147bp	18%	296.9M
tih_rna_sample_00566_23LGNLLT4_1_trimmed_2																																																			79.5%	54%	131bp	147bp	9%	296.9M	79.5%	54%	131bp	147bp	9%	296.9M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁵/₉₅ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_01_RNA_0002_23LGNLLT4_1	641.4M	0.0M	0.0M	47.3M	2.8M	572.9M	286.6M	286.3M	286.5M	286.4M	287.2M	285.6M	571.2M	0.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2	637.7M	0.0M	0.0M	43.6M	2.8M	573.9M	287.1M	286.8M	287.0M	286.9M	283.9M	290.1M	572.3M	0.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3	635.3M	0.0M	0.0M	42.1M	2.9M	573.1M	286.7M	286.4M	286.6M	286.5M	287.6M	285.5M	571.4M	0.0M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1	646.1M	0.0M	0.0M	49.1M	3.2M	574.9M	287.6M	287.3M	287.5M	287.5M	288.9M	286.1M	573.1M	0.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1	648.3M	0.0M	0.0M	53.0M	3.3M	571.2M	285.7M	285.5M	285.6M	285.6M	300.3M	270.9M	569.1M	0.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2	637.6M	0.0M	0.0M	43.7M	3.2M	572.1M	286.2M	285.9M	286.1M	286.0M	294.2M	277.9M	570.2M	0.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3	636.9M	0.0M	0.0M	43.5M	3.2M	571.7M	286.0M	285.7M	285.9M	285.8M	297.3M	274.3M	569.8M	0.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1	656.1M	0.0M	0.0M	61.3M	2.7M	571.3M	285.8M	285.5M	285.7M	285.6M	297.0M	274.3M	569.3M	0.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2	644.9M	0.0M	0.0M	51.4M	2.7M	572.1M	286.2M	285.9M	286.1M	286.0M	290.7M	281.4M	570.1M	0.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3	645.2M	0.0M	0.0M	51.6M	2.7M	572.2M	286.3M	286.0M	286.1M	286.1M	290.3M	281.9M	570.2M	0.0M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1	644.7M	0.0M	0.0M	48.5M	3.4M	573.4M	286.9M	286.5M	286.7M	286.7M	287.2M	286.2M	571.6M	0.0M
NTC_0001_0001_23LGNLLT4_1	2.4M	0.0M	0.0M	1.9M	0.2M	0.1M	0.0M	0.0M	0.0M	0.0M	0.1M	0.0M	0.1M	0.0M
NTC_0001_0001_23LGNLLT4_2	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1	639.9M	0.0M	0.0M	47.9M	3.6M	569.1M	284.7M	284.4M	284.6M	284.5M	293.0M	276.1M	567.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10	640.6M	0.0M	0.0M	48.8M	3.8M	568.5M	284.4M	284.1M	284.3M	284.2M	301.6M	267.0M	566.7M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11	615.3M	0.0M	0.0M	45.7M	3.7M	547.5M	273.9M	273.6M	273.8M	273.7M	298.0M	249.4M	545.9M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12	496.9M	0.0M	0.0M	43.4M	3.1M	434.0M	217.1M	216.9M	217.0M	217.0M	250.3M	183.7M	433.0M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13	516.6M	0.0M	0.0M	40.6M	3.2M	456.7M	228.5M	228.2M	228.4M	228.3M	258.5M	198.2M	455.5M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14	518.4M	0.0M	0.0M	39.5M	3.2M	459.8M	230.0M	229.8M	229.9M	229.9M	264.4M	195.4M	458.7M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15	528.4M	0.0M	0.0M	43.9M	3.3M	464.3M	232.3M	232.0M	232.2M	232.1M	266.4M	197.9M	463.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16	444.3M	0.0M	0.0M	36.8M	2.8M	390.6M	195.4M	195.2M	195.3M	195.3M	225.5M	165.1M	389.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17	648.4M	0.0M	0.0M	56.7M	3.9M	566.2M	283.3M	282.9M	283.1M	283.1M	303.2M	263.0M	564.5M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18	573.8M	0.0M	0.0M	44.4M	3.2M	508.2M	254.2M	254.0M	254.1M	254.1M	281.2M	227.0M	507.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19	602.6M	0.0M	0.0M	50.2M	3.7M	529.3M	264.8M	264.5M	264.7M	264.6M	295.1M	234.2M	527.8M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2	641.1M	0.0M	0.0M	49.9M	3.8M	567.8M	284.1M	283.7M	283.9M	283.9M	300.2M	267.6M	565.9M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20	528.6M	0.0M	0.0M	42.8M	3.2M	465.7M	233.0M	232.7M	232.9M	232.8M	267.3M	198.4M	464.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21	346.4M	0.0M	0.0M	26.5M	2.1M	307.1M	153.7M	153.5M	153.6M	153.5M	174.6M	132.5M	306.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22	430.5M	0.0M	0.0M	36.4M	2.7M	377.3M	188.8M	188.5M	188.7M	188.6M	218.6M	158.7M	376.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23	493.2M	0.0M	0.0M	40.8M	3.1M	433.5M	216.9M	216.6M	216.8M	216.7M	248.7M	184.8M	432.3M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24	570.8M	0.0M	0.0M	50.5M	3.6M	497.8M	249.1M	248.7M	248.9M	248.9M	286.7M	211.1M	496.3M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3	565.2M	0.0M	0.0M	44.7M	3.4M	499.6M	250.0M	249.7M	249.8M	249.8M	271.7M	228.0M	498.2M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4	517.9M	0.0M	0.0M	42.5M	3.2M	455.7M	228.0M	227.7M	227.9M	227.8M	254.7M	201.0M	454.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5	509.3M	0.0M	0.0M	39.6M	3.2M	450.8M	225.6M	225.3M	225.4M	225.4M	252.6M	198.2M	449.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6	511.2M	0.0M	0.0M	39.6M	3.1M	452.9M	226.6M	226.3M	226.5M	226.4M	253.6M	199.3M	451.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7	525.8M	0.0M	0.0M	43.2M	3.3M	462.7M	231.5M	231.2M	231.4M	231.3M	262.8M	199.9M	461.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8	412.2M	0.0M	0.0M	33.5M	2.5M	363.1M	181.6M	181.5M	181.6M	181.5M	210.9M	152.2M	362.2M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9	643.0M	0.0M	0.0M	50.9M	3.6M	568.4M	284.4M	284.1M	284.2M	284.2M	295.9M	272.6M	566.8M	0.0M
tih_rna_sample_00017_23LGNLLT4_1	632.9M	0.0M	0.0M	37.6M	3.3M	576.1M	288.2M	287.9M	288.1M	287.9M	311.5M	264.5M	573.9M	0.0M
tih_rna_sample_00038_23LGNLLT4_1	469.6M	0.0M	0.0M	56.3M	3.5M	390.4M	195.3M	195.1M	195.2M	195.1M	235.1M	155.3M	388.9M	0.0M
tih_rna_sample_00067_23LGNLLT4_1	672.0M	0.0M	0.0M	79.5M	6.3M	553.8M	277.0M	276.7M	276.9M	276.9M	337.6M	216.2M	551.5M	0.0M
tih_rna_sample_00142_23LGNLLT4_1	549.4M	0.0M	0.0M	51.1M	3.7M	476.2M	238.2M	238.0M	238.1M	238.1M	295.2M	181.0M	474.5M	0.0M
tih_rna_sample_00143_23LGNLLT4_1	519.4M	0.0M	0.0M	50.4M	3.2M	447.4M	223.8M	223.6M	223.7M	223.7M	274.0M	173.4M	445.9M	0.0M
tih_rna_sample_00144_23LGNLLT4_1	646.5M	0.0M	0.0M	53.5M	4.0M	568.2M	284.2M	284.0M	284.1M	284.1M	311.1M	257.1M	566.3M	0.0M
tih_rna_sample_00270_23LGNLLT4_1	599.5M	0.0M	0.0M	53.3M	4.2M	521.7M	261.0M	260.8M	260.9M	260.8M	303.5M	218.2M	520.0M	0.0M
tih_rna_sample_00276_23LGNLLT4_1	538.5M	0.0M	0.0M	46.0M	3.7M	471.9M	236.1M	235.8M	236.0M	235.9M	280.9M	190.9M	470.0M	0.0M
tih_rna_sample_00298_23LGNLLT4_1	658.6M	0.0M	0.0M	61.4M	3.7M	569.7M	285.0M	284.7M	284.8M	284.8M	310.7M	258.9M	567.7M	0.0M
tih_rna_sample_00303_23LGNLLT4_1	653.5M	0.0M	0.0M	56.2M	4.5M	570.7M	285.5M	285.2M	285.4M	285.3M	327.1M	243.6M	568.3M	0.0M
tih_rna_sample_00307_23LGNLLT4_1	639.0M	0.0M	0.0M	42.4M	3.1M	576.4M	288.4M	288.1M	288.3M	288.2M	309.0M	267.4M	574.7M	0.0M
tih_rna_sample_00308_23LGNLLT4_1	603.0M	0.0M	0.0M	62.9M	4.2M	515.7M	258.0M	257.6M	257.9M	257.8M	312.6M	203.0M	513.5M	0.0M
tih_rna_sample_00309_23LGNLLT4_1	652.5M	0.0M	0.0M	55.2M	3.1M	572.6M	286.4M	286.2M	286.3M	286.3M	321.5M	251.1M	570.5M	0.0M
tih_rna_sample_00312_23LGNLLT4_1	700.0M	0.0M	0.0M	103.9M	5.9M	558.7M	279.6M	279.1M	279.4M	279.3M	359.6M	199.0M	556.4M	0.0M
tih_rna_sample_00317_23LGNLLT4_1	516.6M	0.0M	0.0M	53.7M	3.8M	439.8M	220.0M	219.8M	219.9M	219.9M	265.6M	174.2M	437.6M	0.0M
tih_rna_sample_00319_23LGNLLT4_1	652.9M	0.0M	0.0M	56.2M	3.3M	569.3M	284.8M	284.5M	284.7M	284.7M	295.1M	274.2M	567.6M	0.0M
tih_rna_sample_00321_23LGNLLT4_1	681.6M	0.0M	0.0M	85.1M	5.0M	562.4M	281.5M	280.9M	281.2M	281.2M	333.1M	229.3M	560.2M	0.0M
tih_rna_sample_00322_23LGNLLT4_1	674.8M	0.0M	0.0M	78.9M	41.0M	530.1M	265.3M	264.8M	265.2M	265.0M	295.7M	234.4M	528.0M	0.0M
tih_rna_sample_00323_23LGNLLT4_1	492.9M	0.0M	0.0M	64.9M	4.6M	404.3M	202.3M	202.0M	202.2M	202.1M	265.8M	138.5M	402.9M	0.0M
tih_rna_sample_00331_23LGNLLT4_1	674.4M	0.0M	0.0M	80.5M	6.2M	562.5M	281.6M	280.9M	281.3M	281.2M	381.8M	180.7M	560.3M	0.0M
tih_rna_sample_00332_23LGNLLT4_1	251.4M	0.0M	0.0M	39.6M	3.0M	198.9M	99.6M	99.3M	99.5M	99.4M	89.4M	109.5M	197.8M	0.0M
tih_rna_sample_00341_23LGNLLT4_1	656.4M	0.0M	0.0M	80.6M	5.2M	544.1M	272.3M	271.8M	272.0M	272.0M	345.1M	198.9M	542.1M	0.0M
tih_rna_sample_00344_23LGNLLT4_1	469.6M	0.0M	0.0M	48.3M	4.2M	400.8M	200.5M	200.2M	200.4M	200.4M	244.2M	156.6M	399.2M	0.0M
tih_rna_sample_00345_23LGNLLT4_1	669.2M	0.0M	0.0M	73.3M	3.7M	569.8M	285.1M	284.7M	284.9M	284.9M	320.8M	249.0M	567.3M	0.0M
tih_rna_sample_00346_23LGNLLT4_1	221.7M	0.0M	0.0M	25.8M	1.9M	185.5M	92.8M	92.7M	92.8M	92.7M	120.6M	64.9M	184.8M	0.0M
tih_rna_sample_00347_23LGNLLT4_1	650.8M	0.0M	0.0M	52.9M	3.6M	574.6M	287.2M	287.4M	287.3M	287.3M	312.2M	262.3M	572.1M	0.0M
tih_rna_sample_00348_23LGNLLT4_1	648.4M	0.0M	0.0M	52.5M	3.4M	573.5M	287.0M	286.6M	286.8M	286.8M	317.6M	255.9M	571.5M	0.0M
tih_rna_sample_00354_23LGNLLT4_1	516.8M	0.0M	0.0M	138.5M	6.0M	318.2M	159.3M	158.9M	159.1M	159.1M	228.1M	90.0M	317.0M	0.0M
tih_rna_sample_00355_23LGNLLT4_1	652.6M	0.0M	0.0M	55.6M	3.8M	570.9M	285.7M	285.3M	285.5M	285.4M	320.0M	250.9M	568.6M	0.0M
tih_rna_sample_00357_23LGNLLT4_1	636.5M	0.0M	0.0M	42.5M	3.6M	573.5M	286.9M	286.6M	286.8M	286.7M	317.4M	256.1M	571.3M	0.0M
tih_rna_sample_00358_23LGNLLT4_1	639.1M	0.0M	0.0M	71.8M	5.4M	538.3M	269.4M	268.9M	269.2M	269.1M	348.1M	190.2M	535.7M	0.0M
tih_rna_sample_00360_23LGNLLT4_1	463.2M	0.0M	0.0M	36.3M	3.6M	409.9M	205.1M	204.9M	205.0M	204.9M	219.6M	190.3M	408.5M	0.0M
tih_rna_sample_00375_23LGNLLT4_1	577.5M	0.0M	0.0M	37.6M	3.1M	521.4M	260.9M	260.5M	260.8M	260.6M	263.0M	258.4M	519.4M	0.0M
tih_rna_sample_00401_23LGNLLT4_1	764.6M	0.0M	0.0M	368.9M	7.6M	313.3M	156.7M	156.7M	156.7M	156.7M	212.5M	100.8M	312.6M	0.0M
tih_rna_sample_00417_23LGNLLT4_1	395.3M	0.0M	0.0M	32.4M	2.5M	348.3M	174.3M	174.1M	174.2M	174.1M	180.8M	167.5M	347.0M	0.0M
tih_rna_sample_00423_23LGNLLT4_1	529.2M	0.0M	0.0M	81.3M	3.7M	417.3M	208.8M	208.5M	208.7M	208.7M	244.6M	172.7M	416.0M	0.0M
tih_rna_sample_00452_23LGNLLT4_1	650.0M	0.0M	0.0M	52.6M	3.4M	573.9M	287.2M	286.8M	287.0M	287.0M	327.5M	246.4M	571.9M	0.0M
tih_rna_sample_00477_23LGNLLT4_1	639.6M	0.0M	0.0M	42.5M	2.8M	577.9M	289.1M	288.8M	289.0M	288.9M	302.9M	275.0M	576.0M	0.0M
tih_rna_sample_00483_23LGNLLT4_1	667.3M	0.0M	0.0M	72.5M	5.4M	563.3M	281.7M	281.6M	281.7M	281.6M	326.9M	236.4M	561.1M	0.0M
tih_rna_sample_00485_23LGNLLT4_1	655.0M	0.0M	0.0M	57.4M	6.5M	564.4M	282.4M	282.1M	282.2M	282.2M	323.5M	241.0M	562.1M	0.0M
tih_rna_sample_00487_23LGNLLT4_1	360.7M	0.0M	0.0M	61.4M	3.8M	278.0M	139.1M	138.8M	139.0M	139.0M	170.5M	107.5M	276.8M	0.0M
tih_rna_sample_00494_23LGNLLT4_1	516.9M	0.0M	0.0M	67.3M	4.0M	425.3M	212.8M	212.5M	212.7M	212.6M	266.6M	158.7M	423.7M	0.0M
tih_rna_sample_00499_23LGNLLT4_1	637.7M	0.0M	0.0M	40.4M	2.8M	577.7M	289.0M	288.7M	288.8M	288.8M	320.7M	256.9M	575.5M	0.0M
tih_rna_sample_00500_23LGNLLT4_1	644.6M	0.0M	0.0M	47.1M	3.2M	576.1M	288.2M	287.9M	288.1M	288.0M	311.0M	265.1M	573.9M	0.0M
tih_rna_sample_00501_23LGNLLT4_1	666.8M	0.0M	0.0M	71.2M	4.3M	566.6M	283.5M	283.1M	283.3M	283.3M	336.4M	230.3M	564.6M	0.0M
tih_rna_sample_00505_23LGNLLT4_1	429.0M	0.0M	0.0M	57.1M	3.7M	350.7M	175.5M	175.2M	175.4M	175.3M	239.5M	111.2M	349.2M	0.0M
tih_rna_sample_00508_23LGNLLT4_1	647.9M	0.0M	0.0M	51.5M	3.8M	574.2M	287.2M	287.0M	287.2M	287.1M	316.4M	257.8M	572.3M	0.0M
tih_rna_sample_00509_23LGNLLT4_1	643.1M	0.0M	0.0M	46.4M	3.2M	575.3M	287.8M	287.5M	287.7M	287.6M	319.6M	255.7M	573.4M	0.0M
tih_rna_sample_00510_23LGNLLT4_1	405.3M	0.0M	0.0M	55.8M	3.6M	329.9M	164.8M	165.0M	164.9M	164.9M	215.9M	114.0M	328.1M	0.0M
tih_rna_sample_00512_23LGNLLT4_1	641.2M	0.0M	0.0M	42.9M	3.4M	580.1M	290.2M	290.0M	290.1M	290.0M	289.4M	290.7M	577.7M	0.0M
tih_rna_sample_00528_23LGNLLT4_1	645.5M	0.0M	0.0M	77.3M	4.3M	539.0M	269.6M	269.5M	269.6M	269.5M	344.9M	194.1M	536.5M	0.0M
tih_rna_sample_00531_23LGNLLT4_1	71.4M	0.0M	0.0M	16.2M	0.8M	50.8M	25.4M	25.4M	25.4M	25.4M	34.3M	16.6M	50.6M	0.0M
tih_rna_sample_00535_23LGNLLT4_1	192.9M	0.0M	0.0M	35.4M	2.1M	146.0M	73.1M	72.9M	73.0M	73.0M	98.9M	47.1M	145.3M	0.0M
tih_rna_sample_00536_23LGNLLT4_1	236.3M	0.0M	0.0M	188.6M	1.9M	18.3M	9.2M	9.1M	9.1M	9.2M	13.1M	5.2M	18.1M	0.0M
tih_rna_sample_00543_23LGNLLT4_1	322.1M	0.0M	0.0M	43.8M	3.1M	262.0M	131.2M	130.9M	131.0M	131.0M	174.9M	87.1M	260.8M	0.0M
tih_rna_sample_00548_23LGNLLT4_1	424.7M	0.0M	0.0M	49.4M	3.3M	356.0M	178.1M	177.9M	178.0M	178.0M	230.5M	125.6M	354.9M	0.0M
tih_rna_sample_00549_23LGNLLT4_1	669.2M	0.0M	0.0M	74.8M	5.4M	563.8M	282.1M	281.7M	281.9M	281.8M	333.5M	230.3M	561.7M	0.0M
tih_rna_sample_00566_23LGNLLT4_1	646.6M	0.0M	0.0M	49.9M	3.2M	574.7M	287.5M	287.2M	287.4M	287.3M	301.9M	272.9M	572.5M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	190	284943651	0.2618%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	11	717273	0.0007%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	11	674449	0.0006%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	8	369630	0.0003%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	6	344503	0.0003%
GTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCC	4	407259	0.0004%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGGGTTTCGGTCCCGCCGC	4	217634	0.0002%
GGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAAAC	4	146788	0.0001%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	4	1045	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	4	1026	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	4	1026	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	4	1058	0.0000%
GGTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGC	3	135559	0.0001%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	3	893	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	3	889	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAG	3	835	0.0000%
GCTGCTGCCGGGGGGGC	3	879	0.0000%
GCTGCTGCCGGGGGGGCC	3	877	0.0000%
GGCCCCCCCGGCAGCAGC	3	867	0.0000%
GTCTCGCTCCCTCGGCCCCGGGATTCGGCGAGTGCTGCTGCCGGGGGGGC	2	171655	0.0002%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	95	81434108	0.1739%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	6	352096	0.0008%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	6	336243	0.0007%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	6	183353	0.0004%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	4	1045	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	4	1026	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	4	1026	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	4	1058	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	4	172902	0.0004%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	3	893	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	3	889	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAG	3	835	0.0000%
GCTGCTGCCGGGGGGGC	3	879	0.0000%
GCTGCTGCCGGGGGGGCC	3	877	0.0000%
GGCCCCCCCGGCAGCAGC	3	867	0.0000%
CTTCGCGCCCTCTCTCTCTCTCTCTCCCCC	2	2017	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	1601	0.0000%
TTCCCCACCGGGCCTTCCCGT	2	899	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	889	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	760	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0002/A23LGNLLT4/nfcore_rnafusion__2cae617--20260515-145204' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0002_2cae617 --rundir 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0237_A23LGNLLT4/' --bclconvert_samplesheet 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0237_A23LGNLLT4/bclconvert_samplesheet.csv' --flowcell_id 20260204_LH00166_0237_A23LGNLLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0002/A23LGNLLT4/nfcore_rnafusion__2cae617--20260515-145204'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0002_2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0002/A23LGNLLT4/nfcore_rnafusion__2cae617--20260515-145204
rundir: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0237_A23LGNLLT4/
flowcell_id: 20260204_LH00166_0237_A23LGNLLT4
strand: reverse
bclconvert_samplesheet: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0237_A23LGNLLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks