Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14862746594(98.4288%)
Q30 bases: 14420338177(95.4989%)
Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14860506512(98.414%)
Q30 bases: 14350301491(95.0351%)
Read1 after filtering:
total reads: 98582191
total bases: 13047089825
Q20 bases: 12987356142(99.5422%)
Q30 bases: 12731404579(97.5804%)
Read2 after filtering:
total reads: 98582191
total bases: 13056965445
Q20 bases: 12970205585(99.3355%)
Q30 bases: 12662530535(96.9791%)
Filtering result:
reads passed filter: 197164382
reads failed due to low quality: 2329152
reads failed due to too many N: 146552
reads failed due to too short: 359914
reads with adapter trimmed: 98988973
bases trimmed due to adapters: 3702869652
Duplication rate: 11.7443%
Insert size peak (evaluated by paired-end reads): 129
JSON report: FFPE_HD789_01_RNA_0002_23LGNLLT4_3.fastp.json
HTML report: FFPE_HD789_01_RNA_0002_23LGNLLT4_3.fastp.html
fastp --in1 FFPE_HD789_01_RNA_0002_23LGNLLT4_3_1.fastq.gz --in2 FFPE_HD789_01_RNA_0002_23LGNLLT4_3_2.fastq.gz --out1 FFPE_HD789_01_RNA_0002_23LGNLLT4_3_1.fastp.fastq.gz --out2 FFPE_HD789_01_RNA_0002_23LGNLLT4_3_2.fastp.fastq.gz --json FFPE_HD789_01_RNA_0002_23LGNLLT4_3.fastp.json --html FFPE_HD789_01_RNA_0002_23LGNLLT4_3.fastp.html --thread 12 --detect_adapter_for_pe
fastp v0.23.4, time used: 258 seconds