Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14943051582(98.9606%)
Q30 bases: 14525185984(96.1933%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14872407124(98.4928%)
Q30 bases: 14369702666(95.1636%)

Read1 after filtering:
total reads: 98723132
total bases: 13240293825
Q20 bases: 13180200668(99.5461%)
Q30 bases: 12920815969(97.5871%)

Read2 after filtering:
total reads: 98723132
total bases: 13248907186
Q20 bases: 13159163216(99.3226%)
Q30 bases: 12841185222(96.9226%)

Filtering result:
reads passed filter: 197446264
reads failed due to low quality: 1981700
reads failed due to too many N: 151298
reads failed due to too short: 420738
reads with adapter trimmed: 91133813
bases trimmed due to adapters: 3355233115

Duplication rate: 11.0927%

Insert size peak (evaluated by paired-end reads): 130

JSON report: FFPE_HD789_01_RNA_0002_23LGNLLT4_1.fastp.json
HTML report: FFPE_HD789_01_RNA_0002_23LGNLLT4_1.fastp.html

fastp --in1 FFPE_HD789_01_RNA_0002_23LGNLLT4_1_1.fastq.gz --in2 FFPE_HD789_01_RNA_0002_23LGNLLT4_1_2.fastq.gz --out1 FFPE_HD789_01_RNA_0002_23LGNLLT4_1_1.fastp.fastq.gz --out2 FFPE_HD789_01_RNA_0002_23LGNLLT4_1_2.fastp.fastq.gz --json FFPE_HD789_01_RNA_0002_23LGNLLT4_1.fastp.json --html FFPE_HD789_01_RNA_0002_23LGNLLT4_1.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 273 seconds