MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-10, 00:12 UTC based on data in: /tmp/nxf.ZEegaWeiOf

General Statistics

Showing ²⁴⁰/₂₄₀ rows and ⁴⁹/₅₆ columns.

Sample Name	Reads	Frac Unmapped	Unique Reads	Frac Dupes	Frac Reads On Target	Frac Reads Off Target	N Q30	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	RNA contaminated	RNA contamination %	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_01_RNA_0002_23LGNLLT4_1	197446264	0.01	161932205	0.18	1	0	0.97	318.93	129.00	1	1	0.000	162.1bp	148.0bp	0.10%	0.83%	0.43%	0.00%	0.22%	2.45%	0.63%	0.00%	Yes	65.48%	9999000000	692905029				206bp	524bp	18.1%	0.0%	95.2%	88.1%	95.8%	94.6M	11.1%	97.3%	25762.0Mb	197.4M	55.5%	98.7%	45.6%
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_1																											162.1bp	95.3%	94.1M																69.1%	54%	151bp	151bp	18%	100.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_2																																													69.6%	55%	151bp	151bp	18%	100.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_trimmed_1																																													69.1%	55%	134bp	151bp	9%	98.7M	69.1%	55%	134bp	151bp	9%	98.7M
FFPE_HD789_01_RNA_0002_23LGNLLT4_1_trimmed_2																																													70.2%	55%	134bp	151bp	9%	98.7M	70.2%	55%	134bp	151bp	9%	98.7M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2	197444458	0.01	160097027	0.19	1	0	0.97	316.27	131.00	1	1	0.000	162.7bp	148.0bp	0.11%	0.82%	0.43%	0.00%	0.24%	2.45%	0.62%	0.00%	Yes	64.56%	9999000000	656767635				211bp	556bp	19.0%	0.0%	95.3%	88.6%	96.0%	94.7M	11.4%	97.3%	25869.7Mb	197.4M	54.9%	98.7%	45.3%
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_1																											162.7bp	95.5%	94.3M																69.6%	54%	151bp	151bp	27%	100.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_2																																													69.1%	54%	151bp	151bp	18%	100.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_trimmed_1																																													69.6%	54%	135bp	151bp	18%	98.7M	69.6%	54%	135bp	151bp	18%	98.7M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2_trimmed_2																																													69.8%	55%	135bp	151bp	9%	98.7M	69.8%	55%	135bp	151bp	9%	98.7M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3	197164382	0.01	157528866	0.20	1	0	0.97	300.33	127.00	1	1	0.000	155.8bp	142.0bp	0.12%	0.83%	0.43%	0.00%	0.26%	2.46%	0.62%	0.00%	Yes	65.53%	9999000000	643242786				191bp	491bp	20.2%	0.0%	95.2%	88.8%	96.0%	94.6M	11.7%	97.3%	25393.9Mb	197.2M	54.3%	98.6%	49.5%
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_1																											155.8bp	95.4%	94.0M																70.3%	53%	151bp	151bp	27%	100.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_2																																													69.4%	54%	151bp	151bp	18%	100.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_trimmed_1																																													70.3%	54%	132bp	151bp	18%	98.6M	70.3%	54%	132bp	151bp	18%	98.6M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3_trimmed_2																																													70.2%	54%	132bp	151bp	9%	98.6M	70.2%	54%	132bp	151bp	9%	98.6M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1	197726452	0.01	167118788	0.15	1	0	0.97	321.35	151.00	1	1	0.000	158.0bp	144.0bp	0.11%	0.95%	0.33%	0.00%	0.24%	2.93%	0.51%	0.00%	Yes	35.76%	9999000000	912064913				183bp	424bp	15.6%	0.0%	95.2%	87.2%	95.2%	94.2M	8.7%	97.2%	25498.9Mb	197.7M	55.6%	98.9%	48.5%
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_1																											158.0bp	95.3%	94.2M																66.3%	54%	151bp	151bp	18%	100.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_2																																													66.7%	55%	151bp	151bp	18%	100.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_trimmed_1																																													66.2%	55%	133bp	151bp	9%	98.9M	66.2%	55%	133bp	151bp	9%	98.9M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1_trimmed_2																																													67.2%	56%	133bp	151bp	9%	98.9M	67.2%	56%	133bp	151bp	9%	98.9M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2	197308180	0.01	163315812	0.17	1	0	0.97	314.76	157.00	1	1	0.000	158.0bp	143.0bp	0.14%	0.93%	0.33%	0.00%	0.31%	2.89%	0.50%	0.00%	Yes	35.89%	9999000000	793548594				187bp	464bp	17.3%	0.0%	95.0%	88.3%	95.6%	94.4M	10.2%	97.3%	25541.3Mb	197.3M	53.9%	98.7%	48.0%
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_1																											158.0bp	95.4%	94.1M																68.9%	53%	151bp	151bp	27%	100.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_2																																													68.3%	53%	151bp	151bp	18%	100.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_trimmed_1																																													68.8%	53%	133bp	151bp	18%	98.7M	68.8%	53%	133bp	151bp	18%	98.7M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2_trimmed_2																																													69.0%	54%	133bp	151bp	9%	98.7M	69.0%	54%	133bp	151bp	9%	98.7M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3	197187196	0.01	162476360	0.18	1	0	0.97	307.21	154.00	1	1	0.000	154.5bp	141.0bp	0.15%	0.95%	0.33%	0.00%	0.34%	2.92%	0.50%	0.00%	Yes	35.76%	9999000000	755700334				178bp	431bp	17.7%	0.0%	94.9%	88.4%	95.7%	94.3M	10.5%	97.3%	25271.9Mb	197.2M	53.6%	98.6%	50.2%
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_1																											154.5bp	95.2%	93.9M																69.4%	53%	151bp	151bp	27%	100.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_2																																													68.8%	53%	151bp	151bp	18%	100.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_trimmed_1																																													69.4%	53%	132bp	151bp	18%	98.6M	69.4%	53%	132bp	151bp	18%	98.6M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3_trimmed_2																																													69.5%	53%	132bp	151bp	9%	98.6M	69.5%	53%	132bp	151bp	9%	98.6M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1	197531966	0.01	157310690	0.20	1	0	0.97	297.13	101.00	1	1	0.000	153.4bp	140.0bp	0.17%	1.04%	0.36%	0.00%	0.34%	3.06%	0.55%	0.00%	No	0.00%	9999000000	660581204				179bp	412bp	20.5%	0.0%	95.3%	86.3%	95.4%	94.2M	12.0%	97.3%	25229.8Mb	197.5M	56.1%	98.8%	51.0%
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_1																											153.4bp	95.3%	94.1M																70.3%	55%	151bp	151bp	18%	100.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_2																																													70.6%	56%	151bp	151bp	18%	100.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_trimmed_1																																													70.3%	55%	131bp	147bp	9%	98.8M	70.3%	55%	131bp	147bp	9%	98.8M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1_trimmed_2																																													71.1%	56%	131bp	147bp	9%	98.8M	71.1%	56%	131bp	147bp	9%	98.8M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2	197096898	0.01	155421931	0.21	1	0	0.97	295.53	106.00	1	1	0.000	154.1bp	141.0bp	0.19%	1.04%	0.36%	0.00%	0.41%	3.10%	0.55%	0.00%	No	0.00%	9999000000	633710790				185bp	454bp	21.3%	0.0%	95.4%	87.4%	95.7%	94.3M	12.9%	97.3%	25333.4Mb	197.1M	54.7%	98.5%	50.1%
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_1																											154.1bp	95.5%	94.1M																71.1%	53%	151bp	151bp	27%	100.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_2																																													70.9%	55%	151bp	151bp	18%	100.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_trimmed_1																																													71.0%	54%	132bp	151bp	18%	98.5M	71.0%	54%	132bp	151bp	18%	98.5M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2_trimmed_2																																													71.7%	55%	132bp	151bp	9%	98.5M	71.7%	55%	132bp	151bp	9%	98.5M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3	197109066	0.01	155269310	0.21	1	0	0.97	295.76	108.00	1	1	0.000	155.7bp	142.0bp	0.19%	1.03%	0.36%	0.00%	0.43%	3.08%	0.54%	0.00%	No	0.00%	9999000000	629735400				187bp	465bp	21.3%	0.0%	95.3%	87.4%	95.7%	94.3M	12.4%	97.3%	25386.6Mb	197.1M	54.4%	98.6%	49.7%
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_1																											155.7bp	95.4%	94.0M																71.3%	54%	151bp	151bp	27%	100.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_2																																													70.9%	54%	151bp	151bp	18%	100.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_trimmed_1																																													71.2%	54%	132bp	151bp	18%	98.6M	71.2%	54%	132bp	151bp	18%	98.6M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3_trimmed_2																																													71.6%	54%	132bp	151bp	9%	98.6M	71.6%	54%	132bp	151bp	9%	98.6M
NTC_0001_0001_23LGNLLT4_2	81812	0.32	46145	0.44	0	0	0.92	0.00	0.00	0	0	0.000	37.1bp	31.0bp	0.00%	0.00%	0.08%	0.00%	0.00%	0.00%	0.21%	0.00%	Yes	100.00%	9999000000	72658				23bp	25bp	64.2%	2.7%	5.9%	3.2%	13.0%	0.0M	54.6%	89.0%	4.2Mb	0.1M	68.1%	6.4%	52.3%
NTC_0001_0001_23LGNLLT4_2_1																											37.1bp	3.2%	0.0M																95.8%	75%	151bp	151bp	64%	0.6M
NTC_0001_0001_23LGNLLT4_2_2																																													93.9%	97%	151bp	151bp	55%	0.6M
NTC_0001_0001_23LGNLLT4_2_trimmed_1																																													50.4%	65%	57bp	32bp	36%	0.0M	50.4%	65%	57bp	32bp	36%	0.0M
NTC_0001_0001_23LGNLLT4_2_trimmed_2																																													53.1%	71%	59bp	32bp	45%	0.0M	53.1%	71%	59bp	32bp	45%	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1	196715926	0.01	153128650	0.22	1	0	0.97	279.07	71.00	1	0	0.000	150.8bp	138.0bp	0.15%	1.23%	0.74%	0.00%	0.29%	3.46%	0.97%	0.00%	No	0.00%	9999000000	553510898				176bp	418bp	22.3%	0.0%	93.8%	88.0%	95.7%	94.1M	13.0%	97.3%	25049.1Mb	196.7M	53.5%	98.4%	52.2%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10	196561296	0.01	148901763	0.24	1	0	0.97	262.41	68.00	1	0	0.000	147.2bp	135.0bp	0.14%	1.18%	0.70%	0.00%	0.27%	3.33%	0.92%	0.00%	No	0.00%	9999000000	426774584				165bp	363bp	24.4%	0.0%	93.3%	87.8%	95.6%	93.9M	14.6%	97.3%	24755.5Mb	196.6M	53.3%	98.3%	54.6%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_1																											147.2bp	93.3%	91.7M																70.0%	52%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_2																																													69.9%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_trimmed_1																																													69.9%	53%	129bp	142bp	18%	98.3M	69.9%	53%	129bp	142bp	18%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10_trimmed_2																																													70.7%	53%	129bp	142bp	9%	98.3M	70.7%	53%	129bp	142bp	9%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11	196731168	0.01	144685868	0.26	1	0	0.97	246.57	65.00	1	0	0.000	143.7bp	132.0bp	0.14%	1.13%	0.68%	0.00%	0.27%	3.17%	0.89%	0.00%	No	0.00%	9990000000	381097605				155bp	314bp	26.6%	0.0%	92.8%	88.0%	95.7%	94.1M	15.2%	97.3%	24560.6Mb	196.7M	53.4%	98.4%	57.3%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_1																											143.7bp	93.0%	91.4M																70.4%	52%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_2																																													69.6%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_trimmed_1																																													70.4%	53%	128bp	137bp	18%	98.4M	70.4%	53%	128bp	137bp	18%	98.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11_trimmed_2																																													70.4%	53%	128bp	142bp	9%	98.4M	70.4%	53%	128bp	142bp	9%	98.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12	195917424	0.01	124958925	0.36	1	0	0.97	189.38	48.00	1	0	0.000	130.3bp	121.0bp	0.17%	1.14%	0.70%	0.00%	0.32%	3.16%	0.88%	0.00%	No	0.00%	9999000000	227735132				130bp	221bp	36.5%	0.0%	92.4%	86.7%	95.4%	93.4M	20.0%	97.3%	23197.5Mb	195.9M	53.5%	98.0%	67.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_1																											130.3bp	92.5%	90.6M																72.7%	52%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_2																																													70.2%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_trimmed_1																																													72.6%	53%	122bp	127bp	18%	98.0M	72.6%	53%	122bp	127bp	18%	98.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12_trimmed_2																																													71.1%	53%	122bp	127bp	9%	98.0M	71.1%	53%	122bp	127bp	9%	98.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13	196276474	0.01	138416029	0.29	1	0	0.97	222.37	58.00	1	0	0.000	137.1bp	126.0bp	0.14%	1.10%	0.67%	0.00%	0.28%	3.08%	0.87%	0.00%	No	0.00%	9990000000	325250760				140bp	252bp	29.7%	0.0%	92.4%	87.5%	95.5%	93.8M	16.1%	97.1%	23824.4Mb	196.3M	53.5%	98.1%	62.9%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_1																											137.1bp	92.7%	91.0M																70.9%	52%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_2																																													69.4%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_trimmed_1																																													70.8%	53%	125bp	132bp	18%	98.1M	70.8%	53%	125bp	132bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13_trimmed_2																																													70.3%	53%	125bp	132bp	9%	98.1M	70.3%	53%	125bp	132bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14	196240722	0.01	131130766	0.33	1	0	0.97	201.92	52.00	1	0	0.000	132.5bp	122.0bp	0.18%	1.10%	0.67%	0.00%	0.34%	3.09%	0.85%	0.00%	No	0.00%	9999000000	266191137				133bp	231bp	33.4%	0.0%	91.9%	87.7%	95.6%	93.8M	20.1%	97.3%	23447.8Mb	196.2M	52.8%	98.1%	65.9%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_1																											132.5bp	92.2%	90.5M																72.0%	52%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_2																																													69.6%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_trimmed_1																																													71.9%	52%	123bp	127bp	18%	98.1M	71.9%	52%	123bp	127bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14_trimmed_2																																													70.4%	53%	123bp	127bp	9%	98.1M	70.4%	53%	123bp	127bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15	196267778	0.01	135871263	0.31	1	0	0.97	214.11	56.00	1	0	0.000	134.6bp	125.0bp	0.14%	1.09%	0.66%	0.00%	0.27%	3.03%	0.86%	0.00%	No	0.00%	9999000000	286903725				138bp	241bp	31.0%	0.0%	92.0%	87.1%	95.4%	93.6M	16.9%	97.2%	23719.8Mb	196.3M	53.7%	98.1%	63.7%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_1																											134.6bp	92.3%	90.5M																70.3%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_2																																													69.0%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_trimmed_1																																													70.2%	53%	124bp	132bp	18%	98.1M	70.2%	53%	124bp	132bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15_trimmed_2																																													69.8%	54%	124bp	132bp	9%	98.1M	69.8%	54%	124bp	132bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16	196161156	0.01	132847368	0.32	1	0	0.97	205.30	53.00	1	0	0.000	132.9bp	123.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	2.99%	0.85%	0.00%	No	0.00%	9999000000	295770718				134bp	226bp	32.5%	0.0%	92.3%	87.3%	95.5%	93.7M	17.6%	97.1%	23463.4Mb	196.2M	53.9%	98.1%	66.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_1																											132.9bp	92.6%	90.8M																70.5%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_2																																													69.3%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_trimmed_1																																													70.5%	53%	123bp	127bp	18%	98.1M	70.5%	53%	123bp	127bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16_trimmed_2																																													70.1%	54%	123bp	127bp	9%	98.1M	70.1%	54%	123bp	127bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17	196552788	0.01	147297707	0.25	1	0	0.97	253.80	63.00	1	0	0.000	142.3bp	131.0bp	0.16%	1.25%	0.76%	0.00%	0.30%	3.47%	0.98%	0.00%	No	0.00%	9999000000	422995695				154bp	327bp	25.3%	0.0%	93.7%	86.7%	95.2%	93.6M	14.1%	97.2%	24279.7Mb	196.6M	54.1%	98.3%	58.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_1																											142.3bp	93.5%	91.9M																70.7%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_2																																													70.1%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_trimmed_1																																													70.6%	53%	127bp	137bp	18%	98.3M	70.6%	53%	127bp	137bp	18%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17_trimmed_2																																													70.9%	54%	127bp	137bp	9%	98.3M	70.9%	54%	127bp	137bp	9%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18	196275826	0.01	135197365	0.31	1	0	0.97	218.61	55.00	1	0	0.000	133.9bp	122.0bp	0.18%	1.23%	0.74%	0.00%	0.34%	3.42%	0.94%	0.00%	No	0.00%	9999000000	311410876				138bp	269bp	31.3%	0.0%	93.3%	87.7%	95.6%	93.9M	17.1%	97.4%	23545.1Mb	196.3M	53.2%	98.1%	64.0%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_1																											133.9bp	93.3%	91.6M																73.2%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_2																																													70.9%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_trimmed_1																																													73.1%	52%	123bp	127bp	18%	98.1M	73.1%	52%	123bp	127bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18_trimmed_2																																													71.6%	53%	123bp	132bp	9%	98.1M	71.6%	53%	123bp	132bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19	196282304	0.01	143235995	0.27	1	0	0.97	235.79	61.00	1	0	0.000	138.4bp	127.0bp	0.15%	1.17%	0.71%	0.00%	0.28%	3.26%	0.91%	0.00%	No	0.00%	9999000000	365151612				144bp	275bp	27.2%	0.0%	92.8%	87.0%	95.4%	93.6M	15.3%	97.2%	23885.9Mb	196.3M	53.8%	98.1%	61.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_1																											138.4bp	92.8%	91.0M																70.5%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_2																																													69.8%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_trimmed_1																																													70.4%	53%	125bp	132bp	18%	98.1M	70.4%	53%	125bp	132bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19_trimmed_2																																													70.5%	54%	125bp	132bp	9%	98.1M	70.5%	54%	125bp	132bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_1																											150.8bp	93.8%	92.2M																70.1%	52%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_2																																													69.8%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_trimmed_1																																													70.1%	53%	131bp	147bp	18%	98.4M	70.1%	53%	131bp	147bp	18%	98.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1_trimmed_2																																													70.5%	53%	131bp	147bp	9%	98.4M	70.5%	53%	131bp	147bp	9%	98.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2	196330880	0.01	146763559	0.25	1	0	0.97	258.87	65.00	1	0	0.000	145.9bp	134.0bp	0.13%	1.17%	0.71%	0.00%	0.24%	3.27%	0.93%	0.00%	No	0.00%	9999000000	399313472				164bp	355bp	25.4%	0.0%	93.7%	87.6%	95.5%	93.8M	14.5%	97.2%	24738.4Mb	196.3M	54.0%	98.2%	55.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20	196126312	0.01	133145727	0.32	1	0	0.97	206.80	53.00	1	0	0.000	131.4bp	122.0bp	0.17%	1.15%	0.70%	0.00%	0.32%	3.19%	0.89%	0.00%	No	0.00%	9999000000	290566223				132bp	232bp	32.4%	0.0%	92.5%	87.3%	95.5%	93.6M	17.3%	97.3%	23271.4Mb	196.1M	53.5%	98.1%	66.3%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_1																											131.4bp	92.7%	90.9M																72.5%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_2																																													70.5%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_trimmed_1																																													72.4%	53%	122bp	127bp	18%	98.1M	72.4%	53%	122bp	127bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20_trimmed_2																																													71.2%	53%	122bp	127bp	9%	98.1M	71.2%	53%	122bp	127bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21	196611816	0.01	130146333	0.34	1	0	0.97	205.03	53.00	1	0	0.000	134.5bp	124.0bp	0.16%	1.10%	0.67%	0.00%	0.29%	3.07%	0.86%	0.00%	No	0.00%	9999000000	251845428				137bp	243bp	34.1%	0.0%	92.5%	87.7%	95.6%	94.0M	18.8%	97.2%	23730.2Mb	196.6M	53.6%	98.3%	64.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_1																											134.5bp	92.8%	91.3M																72.3%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_2																																													70.2%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_trimmed_1																																													72.3%	53%	124bp	132bp	18%	98.3M	72.3%	53%	124bp	132bp	18%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21_trimmed_2																																													71.0%	53%	124bp	132bp	9%	98.3M	71.0%	53%	124bp	132bp	9%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22	196032918	0.01	132618342	0.32	1	0	0.97	204.45	52.00	1	0	0.000	131.9bp	122.0bp	0.15%	1.11%	0.68%	0.00%	0.27%	3.08%	0.87%	0.00%	No	0.00%	9999000000	271823992				132bp	223bp	32.6%	0.0%	92.3%	86.8%	95.3%	93.4M	17.3%	97.2%	23311.2Mb	196.0M	54.0%	98.0%	66.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_1																											131.9bp	92.5%	90.7M																71.7%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_2																																													69.7%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_trimmed_1																																													71.6%	53%	122bp	127bp	18%	98.0M	71.6%	53%	122bp	127bp	18%	98.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22_trimmed_2																																													70.5%	54%	122bp	127bp	9%	98.0M	70.5%	54%	122bp	127bp	9%	98.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23	196259304	0.01	135358934	0.31	1	0	0.97	213.62	55.00	1	0	0.000	134.9bp	125.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	2.99%	0.85%	0.00%	No	0.00%	9990000000	288882376				138bp	240bp	31.3%	0.0%	92.3%	87.0%	95.4%	93.6M	18.8%	97.3%	23756.1Mb	196.3M	54.1%	98.1%	64.0%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_1																											134.9bp	92.5%	90.8M																71.0%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_2																																													69.5%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_trimmed_1																																													70.9%	53%	124bp	132bp	18%	98.1M	70.9%	53%	124bp	132bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23_trimmed_2																																													70.3%	54%	125bp	132bp	9%	98.1M	70.3%	54%	125bp	132bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24	196313150	0.01	141440312	0.28	1	0	0.97	225.25	58.00	1	0	0.000	135.5bp	125.0bp	0.13%	1.09%	0.67%	0.00%	0.25%	3.03%	0.88%	0.00%	No	0.00%	9999000000	344333387				138bp	239bp	28.2%	0.0%	92.3%	86.5%	95.2%	93.5M	14.6%	97.3%	23718.5Mb	196.3M	54.3%	98.2%	63.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_1																											135.5bp	92.5%	90.8M																69.8%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_2																																													69.0%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_trimmed_1																																													69.7%	54%	124bp	132bp	18%	98.2M	69.7%	54%	124bp	132bp	18%	98.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24_trimmed_2																																													69.8%	54%	124bp	132bp	9%	98.2M	69.8%	54%	124bp	132bp	9%	98.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_1																											145.9bp	93.7%	92.0M																70.1%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_2																																													69.4%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_trimmed_1																																													70.0%	53%	130bp	142bp	18%	98.2M	70.0%	53%	130bp	142bp	18%	98.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2_trimmed_2																																													70.3%	54%	130bp	142bp	9%	98.2M	70.3%	54%	130bp	142bp	9%	98.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3	196443254	0.01	145014948	0.26	1	0	0.97	246.99	65.00	1	0	0.000	144.7bp	133.0bp	0.13%	1.14%	0.68%	0.00%	0.25%	3.19%	0.88%	0.00%	No	0.00%	9999000000	395613981				155bp	312bp	26.4%	0.0%	92.7%	87.6%	95.5%	93.8M	14.6%	97.0%	24462.6Mb	196.4M	53.5%	98.2%	57.3%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_1																											144.7bp	92.7%	91.1M																70.1%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_2																																													69.3%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_trimmed_1																																													70.1%	53%	128bp	142bp	18%	98.2M	70.1%	53%	128bp	142bp	18%	98.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3_trimmed_2																																													70.0%	53%	128bp	142bp	9%	98.2M	70.0%	53%	128bp	142bp	9%	98.2M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4	196146308	0.01	144195568	0.26	1	0	0.97	237.37	63.00	1	0	0.000	138.8bp	128.0bp	0.14%	1.12%	0.68%	0.00%	0.27%	3.14%	0.88%	0.00%	No	0.00%	9999000000	380283292				146bp	273bp	26.7%	0.0%	92.4%	87.2%	95.4%	93.6M	14.9%	97.3%	24069.6Mb	196.1M	53.6%	98.1%	60.5%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_1																											138.8bp	92.6%	90.8M																69.4%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_2																																													68.9%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_trimmed_1																																													69.3%	53%	126bp	137bp	18%	98.1M	69.3%	53%	126bp	137bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4_trimmed_2																																													69.6%	53%	126bp	137bp	9%	98.1M	69.6%	53%	126bp	137bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5	196270078	0.01	141797314	0.28	1	0	0.97	232.87	62.00	1	0	0.000	140.9bp	130.0bp	0.14%	1.08%	0.66%	0.00%	0.27%	3.04%	0.86%	0.00%	No	0.00%	9999000000	341081685				146bp	269bp	28.0%	0.0%	92.2%	87.6%	95.5%	93.8M	15.9%	97.2%	24210.9Mb	196.3M	53.4%	98.1%	60.1%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_1																											140.9bp	92.4%	90.7M																70.0%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_2																																													69.4%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_trimmed_1																																													69.9%	53%	127bp	137bp	18%	98.1M	69.9%	53%	127bp	137bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5_trimmed_2																																													70.1%	53%	127bp	137bp	9%	98.1M	70.1%	53%	127bp	137bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6	196519478	0.01	142736341	0.27	1	0	0.97	234.57	63.00	1	0	0.000	141.1bp	131.0bp	0.13%	1.07%	0.65%	0.00%	0.25%	3.01%	0.85%	0.00%	No	0.00%	9999000000	352802525				147bp	268bp	27.6%	0.0%	92.1%	87.6%	95.6%	93.9M	15.6%	97.2%	24321.1Mb	196.5M	53.4%	98.3%	60.2%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_1																											141.1bp	92.4%	90.8M																69.2%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_2																																													68.5%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_trimmed_1																																													69.1%	53%	127bp	137bp	18%	98.3M	69.1%	53%	127bp	137bp	18%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6_trimmed_2																																													69.3%	53%	127bp	137bp	9%	98.3M	69.3%	53%	127bp	137bp	9%	98.3M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7	196103982	0.01	137014256	0.30	1	0	0.97	220.26	57.00	1	0	0.000	137.3bp	127.0bp	0.13%	1.07%	0.66%	0.00%	0.26%	3.00%	0.85%	0.00%	No	0.00%	9999000000	295626627				142bp	253bp	30.4%	0.0%	92.5%	87.1%	95.4%	93.6M	17.1%	97.3%	23916.8Mb	196.1M	53.8%	98.1%	62.2%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_1																											137.3bp	92.7%	90.9M																69.5%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_2																																													68.5%	53%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_trimmed_1																																													69.5%	53%	125bp	132bp	18%	98.1M	69.5%	53%	125bp	132bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7_trimmed_2																																													69.4%	54%	125bp	132bp	9%	98.1M	69.4%	54%	125bp	132bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8	196236978	0.01	130280637	0.34	1	0	0.97	197.81	51.00	1	0	0.000	130.3bp	121.0bp	0.16%	1.09%	0.67%	0.00%	0.29%	3.03%	0.86%	0.00%	No	0.00%	9999000000	260981248				131bp	216bp	33.9%	0.0%	92.2%	87.4%	95.5%	93.8M	18.4%	97.2%	23278.0Mb	196.2M	53.6%	98.1%	67.9%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_1																											130.3bp	92.5%	90.8M																71.3%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_2																																													69.5%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_trimmed_1																																													71.2%	53%	122bp	127bp	18%	98.1M	71.2%	53%	122bp	127bp	18%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8_trimmed_2																																													70.2%	53%	122bp	127bp	9%	98.1M	70.2%	53%	122bp	127bp	9%	98.1M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9	196739496	0.01	150914831	0.23	1	0	0.97	269.92	67.00	1	0	0.000	147.5bp	135.0bp	0.14%	1.24%	0.75%	0.00%	0.26%	3.46%	0.97%	0.00%	No	0.00%	9999000000	509962546				167bp	381bp	23.5%	0.0%	94.1%	87.5%	95.5%	94.0M	13.2%	97.3%	24742.8Mb	196.7M	53.9%	98.4%	54.8%
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_1																											147.5bp	94.0%	92.5M																70.9%	53%	151bp	151bp	27%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_2																																													69.8%	54%	151bp	151bp	18%	100.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_trimmed_1																																													70.8%	53%	129bp	142bp	18%	98.4M	70.8%	53%	129bp	142bp	18%	98.4M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9_trimmed_2																																													70.6%	54%	129bp	142bp	9%	98.4M	70.6%	54%	129bp	142bp	9%	98.4M
tih_rna_sample_00017_23LGNLLT4_1	197630620	0.01	131322431	0.34	1	0	0.97	213.85	97.00	1	0	0.000	132.8bp	123.0bp	0.06%	0.32%	0.28%	0.00%	0.13%	1.10%	0.40%	0.00%	No	0.00%	9990000000	359645291				150bp	289bp	33.8%	0.0%	93.6%	89.6%	95.9%	94.8M	18.7%	97.3%	23961.0Mb	197.6M	55.0%	98.8%	64.2%
tih_rna_sample_00017_23LGNLLT4_1_1																											132.8bp	94.3%	93.2M																71.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00017_23LGNLLT4_1_2																																													68.7%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00017_23LGNLLT4_1_trimmed_1																																													71.0%	54%	125bp	132bp	18%	98.8M	71.0%	54%	125bp	132bp	18%	98.8M
tih_rna_sample_00017_23LGNLLT4_1_trimmed_2																																													69.3%	55%	125bp	132bp	9%	98.8M	69.3%	55%	125bp	132bp	9%	98.8M
tih_rna_sample_00038_23LGNLLT4_1	196004412	0.01	132459338	0.32	1	0	0.97	205.57	92.00	1	0	0.000	134.5bp	126.0bp	0.23%	0.70%	0.26%	0.00%	0.49%	2.19%	0.41%	0.00%	No	0.00%	9999000000	282083629				137bp	211bp	32.8%	0.0%	91.7%	83.2%	93.9%	92.0M	17.7%	97.1%	23792.1Mb	196.0M	56.9%	98.0%	64.1%
tih_rna_sample_00038_23LGNLLT4_1_1																											134.5bp	92.0%	90.2M																64.9%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00038_23LGNLLT4_1_2																																													64.7%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00038_23LGNLLT4_1_trimmed_1																																													64.7%	56%	125bp	132bp	18%	98.0M	64.7%	56%	125bp	132bp	18%	98.0M
tih_rna_sample_00038_23LGNLLT4_1_trimmed_2																																													65.4%	57%	125bp	132bp	9%	98.0M	65.4%	57%	125bp	132bp	9%	98.0M
tih_rna_sample_00067_23LGNLLT4_1	196469318	0.04	137734120	0.30	1	0	0.97	199.07	75.00	1	0	0.000	122.6bp	116.0bp	0.19%	0.35%	0.23%	0.00%	0.40%	1.11%	0.35%	0.00%	No	0.00%	9999000000	332566696				126bp	196bp	31.0%	0.0%	94.0%	80.9%	91.0%	89.4M	14.5%	97.2%	22706.1Mb	196.5M	57.7%	98.2%	73.0%
tih_rna_sample_00067_23LGNLLT4_1_1																											122.6bp	94.5%	92.8M																66.7%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00067_23LGNLLT4_1_2																																													65.6%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00067_23LGNLLT4_1_trimmed_1																																													66.5%	57%	119bp	122bp	18%	98.2M	66.5%	57%	119bp	122bp	18%	98.2M
tih_rna_sample_00067_23LGNLLT4_1_trimmed_2																																													66.3%	57%	119bp	122bp	9%	98.2M	66.3%	57%	119bp	122bp	9%	98.2M
tih_rna_sample_00142_23LGNLLT4_1	196206426	0.01	142468902	0.27	1	0	0.97	210.94	87.00	1	0	0.000	130.9bp	123.0bp	0.74%	0.19%	0.14%	0.00%	1.51%	0.58%	0.20%	0.00%	No	0.00%	9999000000	393593139				129bp	189bp	27.6%	0.0%	90.5%	85.9%	94.9%	93.1M	13.5%	97.1%	23292.8Mb	196.2M	55.0%	98.1%	67.5%
tih_rna_sample_00142_23LGNLLT4_1_1																											130.9bp	90.9%	89.2M																62.8%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00142_23LGNLLT4_1_2																																													62.2%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00142_23LGNLLT4_1_trimmed_1																																													62.6%	54%	122bp	127bp	18%	98.1M	62.6%	54%	122bp	127bp	18%	98.1M
tih_rna_sample_00142_23LGNLLT4_1_trimmed_2																																													62.8%	55%	122bp	127bp	9%	98.1M	62.8%	55%	122bp	127bp	9%	98.1M
tih_rna_sample_00143_23LGNLLT4_1	196185718	0.01	137333631	0.30	1	0	0.97	207.00	95.00	1	0	0.000	129.2bp	120.0bp	0.11%	0.91%	0.24%	0.00%	0.24%	2.78%	0.39%	0.00%	No	0.00%	9999000000	301020867				128bp	190bp	30.2%	0.0%	92.4%	85.5%	94.8%	93.0M	15.4%	97.1%	23099.8Mb	196.2M	55.8%	98.1%	68.9%
tih_rna_sample_00143_23LGNLLT4_1_1																											129.2bp	92.7%	90.9M																64.3%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00143_23LGNLLT4_1_2																																													63.9%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00143_23LGNLLT4_1_trimmed_1																																													64.2%	55%	121bp	127bp	18%	98.1M	64.2%	55%	121bp	127bp	18%	98.1M
tih_rna_sample_00143_23LGNLLT4_1_trimmed_2																																													64.6%	56%	121bp	127bp	9%	98.1M	64.6%	56%	121bp	127bp	9%	98.1M
tih_rna_sample_00144_23LGNLLT4_1	196864962	0.01	150832612	0.23	1	0	0.97	253.70	111.00	1	1	0.000	136.0bp	126.0bp	0.11%	0.35%	0.24%	0.00%	0.23%	1.07%	0.36%	0.00%	No	0.00%	9999000000	525268613				145bp	288bp	23.6%	0.0%	94.3%	86.7%	95.1%	93.6M	11.9%	97.3%	23964.7Mb	196.9M	54.7%	98.4%	62.6%
tih_rna_sample_00144_23LGNLLT4_1_1																											136.0bp	94.5%	93.1M																67.6%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00144_23LGNLLT4_1_2																																													66.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00144_23LGNLLT4_1_trimmed_1																																													67.6%	54%	125bp	132bp	18%	98.4M	67.6%	54%	125bp	132bp	18%	98.4M
tih_rna_sample_00144_23LGNLLT4_1_trimmed_2																																													66.9%	54%	125bp	132bp	9%	98.4M	66.9%	54%	125bp	132bp	9%	98.4M
tih_rna_sample_00270_23LGNLLT4_1	196406014	0.01	108829399	0.45	1	0	0.97	160.23	68.00	1	0	0.000	126.1bp	120.0bp	0.10%	0.41%	0.26%	0.00%	0.23%	1.29%	0.36%	0.00%	No	0.00%	9999000000	147471024				128bp	205bp	45.1%	0.0%	94.7%	86.5%	94.9%	93.2M	24.8%	97.3%	23120.2Mb	196.4M	56.2%	98.2%	71.5%
tih_rna_sample_00270_23LGNLLT4_1_1																											126.1bp	94.8%	93.1M																71.5%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00270_23LGNLLT4_1_2																																													68.6%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00270_23LGNLLT4_1_trimmed_1																																													71.4%	55%	121bp	122bp	18%	98.2M	71.4%	55%	121bp	122bp	18%	98.2M
tih_rna_sample_00270_23LGNLLT4_1_trimmed_2																																													69.3%	56%	121bp	122bp	9%	98.2M	69.3%	56%	121bp	122bp	9%	98.2M
tih_rna_sample_00276_23LGNLLT4_1	196040466	0.01	136052615	0.31	1	0	0.97	206.98	91.00	1	0	0.000	129.4bp	122.0bp	0.04%	0.29%	0.22%	0.00%	0.10%	1.05%	0.36%	0.00%	No	0.00%	9999000000	387625689				134bp	211bp	30.9%	0.0%	92.3%	86.5%	95.0%	93.1M	14.9%	97.2%	23269.7Mb	196.0M	56.0%	98.0%	68.4%
tih_rna_sample_00276_23LGNLLT4_1_1																											129.4bp	93.2%	91.4M																64.8%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00276_23LGNLLT4_1_2																																													64.0%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00276_23LGNLLT4_1_trimmed_1																																													64.7%	55%	122bp	127bp	18%	98.0M	64.7%	55%	122bp	127bp	18%	98.0M
tih_rna_sample_00276_23LGNLLT4_1_trimmed_2																																													64.7%	56%	122bp	127bp	9%	98.0M	64.7%	56%	122bp	127bp	9%	98.0M
tih_rna_sample_00346_23LGNLLT4_1	188597164	0.01	58217131	0.69	1	0	0.97	57.72	22.00	0	0	0.000	116.4bp	112.0bp	0.11%	0.61%	0.20%	0.00%	0.22%	1.88%	0.32%	0.00%	No	0.00%	9999000000	81109756				115bp	147bp	70.0%	0.0%	91.3%	84.1%	94.1%	88.7M	40.5%	97.3%	20959.4Mb	188.6M	55.8%	94.3%	79.0%
tih_rna_sample_00346_23LGNLLT4_1_1																											116.4bp	90.9%	85.7M																75.6%	55%	151bp	151bp	45%	100.0M
tih_rna_sample_00346_23LGNLLT4_1_2																																													73.6%	56%	151bp	151bp	45%	100.0M
tih_rna_sample_00346_23LGNLLT4_1_trimmed_1																																													74.5%	55%	114bp	117bp	18%	94.3M	74.5%	55%	114bp	117bp	18%	94.3M
tih_rna_sample_00346_23LGNLLT4_1_trimmed_2																																													73.7%	56%	114bp	117bp	9%	94.3M	73.7%	56%	114bp	117bp	9%	94.3M
tih_rna_sample_00357_23LGNLLT4_1	197115152	0.01	142195803	0.28	1	0	0.97	232.05	89.00	1	0	0.000	129.5bp	121.0bp	0.05%	0.27%	0.33%	0.00%	0.12%	0.92%	0.50%	0.00%	No	0.00%	9999000000	492940917				137bp	252bp	28.0%	0.0%	95.2%	88.7%	95.8%	94.4M	12.5%	97.2%	23471.5Mb	197.1M	55.4%	98.6%	68.0%
tih_rna_sample_00357_23LGNLLT4_1_1																											129.5bp	95.5%	94.1M																67.6%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00357_23LGNLLT4_1_2																																													65.9%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00357_23LGNLLT4_1_trimmed_1																																													67.6%	55%	122bp	127bp	18%	98.6M	67.6%	55%	122bp	127bp	18%	98.6M
tih_rna_sample_00357_23LGNLLT4_1_trimmed_2																																													66.6%	55%	123bp	127bp	9%	98.6M	66.6%	55%	123bp	127bp	9%	98.6M
tih_rna_sample_00375_23LGNLLT4_1	196258868	0.01	102626060	0.48	1	0	0.97	159.41	71.00	1	0	0.000	129.0bp	121.0bp	0.16%	0.28%	0.22%	0.00%	0.38%	1.00%	0.37%	0.00%	No	0.00%	9990000000	188726130				153bp	335bp	48.1%	0.0%	94.6%	88.7%	95.7%	93.9M	28.4%	97.3%	23403.2Mb	196.3M	55.2%	98.1%	67.7%
tih_rna_sample_00375_23LGNLLT4_1_1																											129.0bp	95.2%	93.4M																73.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00375_23LGNLLT4_1_2																																													72.0%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00375_23LGNLLT4_1_trimmed_1																																													72.9%	54%	122bp	127bp	18%	98.1M	72.9%	54%	122bp	127bp	18%	98.1M
tih_rna_sample_00375_23LGNLLT4_1_trimmed_2																																													72.8%	55%	123bp	127bp	18%	98.1M	72.8%	55%	123bp	127bp	18%	98.1M
tih_rna_sample_00401_23LGNLLT4_1	196749332	0.15	119510862	0.39	1	0	0.97	105.77	35.00	1	0	0.000	95.3bp	91.0bp	0.79%	0.72%	0.27%	0.00%	1.61%	2.01%	0.40%	0.00%	No	0.00%	9999000000	173309828				93bp	120bp	46.2%	0.0%	94.0%	67.7%	79.1%	77.8M	16.6%	97.2%	17567.3Mb	196.7M	57.7%	98.4%	91.2%
tih_rna_sample_00401_23LGNLLT4_1_1																											95.3bp	83.7%	82.3M																75.4%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00401_23LGNLLT4_1_2																																													72.7%	57%	151bp	151bp	36%	100.0M
tih_rna_sample_00401_23LGNLLT4_1_trimmed_1																																													75.4%	57%	92bp	92bp	18%	98.4M	75.4%	57%	92bp	92bp	18%	98.4M
tih_rna_sample_00401_23LGNLLT4_1_trimmed_2																																													73.3%	57%	92bp	92bp	9%	98.4M	73.3%	57%	92bp	92bp	9%	98.4M
tih_rna_sample_00417_23LGNLLT4_1	193775362	0.01	83257369	0.57	1	0	0.97	123.86	57.00	1	0	0.000	136.4bp	128.0bp	0.08%	0.31%	0.16%	0.00%	0.16%	1.11%	0.27%	0.00%	No	0.00%	9999000000	136450949				162bp	329bp	57.5%	0.0%	92.8%	86.4%	95.2%	92.2M	38.4%	97.1%	23881.4Mb	193.8M	55.7%	96.9%	61.8%
tih_rna_sample_00417_23LGNLLT4_1_1																											136.4bp	93.5%	90.6M																74.4%	55%	151bp	151bp	45%	100.0M
tih_rna_sample_00417_23LGNLLT4_1_2																																													73.2%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00417_23LGNLLT4_1_trimmed_1																																													74.0%	55%	127bp	137bp	27%	96.9M	74.0%	55%	127bp	137bp	27%	96.9M
tih_rna_sample_00417_23LGNLLT4_1_trimmed_2																																													74.0%	55%	127bp	137bp	18%	96.9M	74.0%	55%	127bp	137bp	18%	96.9M
tih_rna_sample_00423_23LGNLLT4_1	195916554	0.02	124424591	0.36	1	0	0.97	203.69	85.00	1	0	0.000	142.0bp	133.0bp	0.21%	0.71%	0.20%	0.00%	0.45%	2.23%	0.33%	0.00%	No	0.00%	9999000000	236746492				150bp	247bp	37.1%	0.0%	92.7%	78.5%	92.2%	90.3M	23.2%	97.2%	24620.2Mb	195.9M	57.5%	98.0%	57.6%
tih_rna_sample_00423_23LGNLLT4_1_1																											142.0bp	93.1%	91.2M																70.1%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00423_23LGNLLT4_1_2																																													69.1%	57%	151bp	151bp	18%	100.0M
tih_rna_sample_00423_23LGNLLT4_1_trimmed_1																																													69.9%	57%	129bp	142bp	18%	98.0M	69.9%	57%	129bp	142bp	18%	98.0M
tih_rna_sample_00423_23LGNLLT4_1_trimmed_2																																													70.0%	57%	129bp	142bp	9%	98.0M	70.0%	57%	129bp	142bp	9%	98.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: SeqTools	Reads	SeqTools Reads	`reads`	None
\|\|	Custom content: SeqTools	Frac Unmapped	SeqTools Frac Unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools	Unique Reads	SeqTools Unique Reads	`unique_reads`	None
\|\|	Custom content: SeqTools	Frac Dupes	SeqTools Frac Dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools	Frac Reads On Target	SeqTools Frac Reads On Target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools	Frac Reads Off Target	SeqTools Frac Reads Off Target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools	N Q30	SeqTools N Q30	`n_q30`	None
\|\|	Custom content: SeqTools	Mean Depth	SeqTools Mean Depth	`mean_depth`	None
\|\|	Custom content: SeqTools	Q50 Depth	SeqTools Q50 Depth	`q50_depth`	None
\|\|	Custom content: SeqTools	Frac Bases Gt30X	SeqTools Frac Bases Gt30X	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools	Frac Bases Gt100X	SeqTools Frac Bases Gt100X	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools	GC Bias	Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_01_RNA_0002_23LGNLLT4_1	215.8M	0.0M	0.0M	17.8M	1.2M	190.7M	95.4M	95.3M	95.3M	95.3M	95.2M	95.5M	190.1M	0.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_2	214.9M	0.0M	0.0M	16.8M	1.2M	191.0M	95.5M	95.4M	95.5M	95.5M	94.1M	96.9M	190.4M	0.0M
FFPE_HD789_01_RNA_0002_23LGNLLT4_3	214.2M	0.0M	0.0M	16.5M	1.2M	190.7M	95.4M	95.3M	95.4M	95.4M	95.3M	95.4M	190.2M	0.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_1	217.4M	0.0M	0.0M	18.9M	1.4M	190.2M	95.1M	95.1M	95.1M	95.1M	99.7M	90.5M	189.5M	0.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_2	215.0M	0.0M	0.0M	17.0M	1.4M	190.5M	95.3M	95.2M	95.2M	95.2M	97.6M	92.8M	189.8M	0.0M
FFPE_HD834_01_RNA_0001_23LGNLLT4_3	214.7M	0.0M	0.0M	16.8M	1.4M	190.3M	95.2M	95.1M	95.2M	95.1M	98.7M	91.6M	189.7M	0.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_1	219.6M	0.0M	0.0M	21.3M	1.1M	190.2M	95.1M	95.0M	95.1M	95.1M	98.4M	91.8M	189.5M	0.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_2	217.1M	0.0M	0.0M	19.3M	1.0M	190.4M	95.3M	95.1M	95.2M	95.2M	96.3M	94.1M	189.8M	0.0M
FFPE_HD835_01_RNA_0001_23LGNLLT4_3	217.1M	0.0M	0.0M	19.2M	1.0M	190.5M	95.3M	95.2M	95.2M	95.2M	96.1M	94.3M	189.8M	0.0M
NTC_0001_0001_23LGNLLT4_2	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_1	215.0M	0.0M	0.0M	17.6M	1.3M	189.7M	94.9M	94.8M	94.8M	94.8M	97.3M	92.3M	189.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_10	215.2M	0.0M	0.0M	17.9M	1.4M	189.5M	94.8M	94.7M	94.7M	94.7M	100.2M	89.3M	188.9M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_11	214.9M	0.0M	0.0M	17.6M	1.4M	189.6M	94.9M	94.8M	94.8M	94.8M	103.0M	86.7M	189.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_12	216.4M	0.0M	0.0M	19.9M	1.5M	188.0M	94.0M	93.9M	94.0M	94.0M	108.1M	79.8M	187.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_13	215.3M	0.0M	0.0M	18.4M	1.5M	188.9M	94.5M	94.4M	94.5M	94.4M	106.6M	82.3M	188.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_14	214.8M	0.0M	0.0M	18.1M	1.5M	188.8M	94.4M	94.3M	94.4M	94.4M	108.3M	80.4M	188.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_15	216.1M	0.0M	0.0M	19.2M	1.5M	188.6M	94.4M	94.3M	94.3M	94.3M	108.0M	80.7M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_16	215.6M	0.0M	0.0M	18.8M	1.5M	188.6M	94.3M	94.3M	94.3M	94.3M	108.5M	80.1M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_17	217.1M	0.0M	0.0M	19.9M	1.5M	188.7M	94.4M	94.3M	94.3M	94.3M	100.7M	87.9M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_18	214.9M	0.0M	0.0M	18.2M	1.4M	188.8M	94.5M	94.4M	94.4M	94.4M	104.2M	84.6M	188.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_19	216.2M	0.0M	0.0M	19.3M	1.5M	188.6M	94.4M	94.2M	94.3M	94.3M	104.9M	83.7M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_2	215.4M	0.0M	0.0M	18.3M	1.4M	189.2M	94.6M	94.5M	94.6M	94.6M	99.7M	89.4M	188.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_20	215.4M	0.0M	0.0M	18.8M	1.5M	188.4M	94.3M	94.2M	94.2M	94.2M	107.9M	80.5M	188.0M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_21	215.3M	0.0M	0.0M	18.2M	1.4M	189.2M	94.7M	94.6M	94.6M	94.6M	107.3M	81.9M	188.8M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_22	216.3M	0.0M	0.0M	19.7M	1.6M	188.1M	94.1M	94.0M	94.1M	94.1M	108.7M	79.4M	187.7M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_23	216.2M	0.0M	0.0M	19.3M	1.5M	188.5M	94.3M	94.2M	94.3M	94.3M	107.9M	80.7M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_24	217.3M	0.0M	0.0M	20.3M	1.6M	188.4M	94.3M	94.1M	94.2M	94.2M	108.2M	80.2M	187.9M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_3	215.3M	0.0M	0.0M	18.2M	1.5M	189.1M	94.6M	94.5M	94.6M	94.6M	102.6M	86.5M	188.6M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_4	215.6M	0.0M	0.0M	18.8M	1.5M	188.6M	94.4M	94.3M	94.3M	94.3M	105.2M	83.5M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_5	215.2M	0.0M	0.0M	18.3M	1.5M	189.0M	94.5M	94.4M	94.5M	94.5M	105.6M	83.3M	188.4M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_6	215.5M	0.0M	0.0M	18.3M	1.4M	189.3M	94.7M	94.6M	94.6M	94.6M	105.7M	83.5M	188.7M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_7	215.8M	0.0M	0.0M	19.1M	1.5M	188.6M	94.4M	94.3M	94.3M	94.3M	106.9M	81.7M	188.1M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_8	215.5M	0.0M	0.0M	18.7M	1.5M	188.7M	94.4M	94.3M	94.4M	94.3M	109.3M	79.4M	188.3M	0.0M
SS_FFPE_V4_0001_RNA_0011_23LGNLLT4_9	216.0M	0.0M	0.0M	18.6M	1.3M	189.5M	94.8M	94.7M	94.7M	94.7M	98.3M	91.1M	188.9M	0.0M
tih_rna_sample_00017_23LGNLLT4_1	212.9M	0.0M	0.0M	14.5M	1.4M	191.5M	95.8M	95.7M	95.8M	95.7M	103.2M	88.3M	190.8M	0.0M
tih_rna_sample_00038_23LGNLLT4_1	222.8M	0.0M	0.0M	25.9M	2.1M	185.9M	93.0M	92.9M	93.0M	93.0M	111.5M	74.4M	185.3M	0.0M
tih_rna_sample_00067_23LGNLLT4_1	222.8M	0.0M	0.0M	25.4M	7.2M	180.9M	90.5M	90.4M	90.4M	90.4M	107.5M	73.3M	180.2M	0.0M
tih_rna_sample_00142_23LGNLLT4_1	218.1M	0.0M	0.0M	21.1M	1.7M	188.0M	94.1M	94.0M	94.0M	94.0M	116.3M	71.8M	187.4M	0.0M
tih_rna_sample_00143_23LGNLLT4_1	218.9M	0.0M	0.0M	22.0M	1.6M	187.8M	94.0M	93.8M	93.9M	93.9M	114.6M	73.2M	187.2M	0.0M
tih_rna_sample_00144_23LGNLLT4_1	217.3M	0.0M	0.0M	19.6M	1.7M	189.0M	94.5M	94.4M	94.5M	94.5M	102.5M	86.5M	188.3M	0.0M
tih_rna_sample_00270_23LGNLLT4_1	216.7M	0.0M	0.0M	19.5M	2.1M	188.0M	94.0M	94.0M	94.0M	94.0M	108.8M	79.2M	187.4M	0.0M
tih_rna_sample_00276_23LGNLLT4_1	216.7M	0.0M	0.0M	19.8M	1.7M	188.2M	94.2M	94.1M	94.1M	94.1M	111.7M	76.6M	187.5M	0.0M
tih_rna_sample_00346_23LGNLLT4_1	212.4M	0.0M	0.0M	22.9M	2.3M	179.5M	89.8M	89.7M	89.7M	89.7M	116.4M	63.1M	178.8M	0.0M
tih_rna_sample_00357_23LGNLLT4_1	214.3M	0.0M	0.0M	16.3M	1.3M	190.7M	95.4M	95.3M	95.4M	95.4M	105.2M	85.6M	190.1M	0.0M
tih_rna_sample_00375_23LGNLLT4_1	213.2M	0.0M	0.0M	16.1M	1.4M	189.8M	95.0M	94.9M	95.0M	94.9M	95.4M	94.5M	189.1M	0.0M
tih_rna_sample_00401_23LGNLLT4_1	230.7M	0.0M	0.0M	33.3M	29.4M	156.6M	78.3M	78.3M	78.3M	78.3M	104.8M	51.8M	156.2M	0.0M
tih_rna_sample_00417_23LGNLLT4_1	214.8M	0.0M	0.0M	20.2M	1.5M	186.3M	93.2M	93.1M	93.2M	93.1M	96.1M	90.2M	185.6M	0.0M
tih_rna_sample_00423_23LGNLLT4_1	231.4M	0.0M	0.0M	34.8M	3.3M	182.2M	91.2M	91.1M	91.1M	91.1M	105.8M	76.5M	181.7M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	66342083	0.3561%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	4015	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	3349	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACGCACTACCAGATCTGGGG	2	1440	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	702	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	209	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	228	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	229	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	206	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATAGACAACATCTAGT	1	127738	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCAGGAATTATCTAGT	1	377119	0.0020%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCAGGAATTATCTGGT	1	121041	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCCGGTTATCTAGT	1	317668	0.0017%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCCGGTTATCTGGT	1	137953	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTCAGGCTTATCTAGT	1	120172	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTGACTATGATCTGGG	1	110563	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGAAGCACAATCTGGG	1	346630	0.0019%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGCTGTCAATCTGGT	1	241017	0.0013%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGCTGTCAATCTGGG	1	108644	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCTATACTGATCTGGG	1	225888	0.0012%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	48	23023907	0.2495%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	1989	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	1672	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	702	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	209	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	228	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	229	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	206	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACGCACTACCAGATCTGGGG	1	709	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	1	583	0.0000%
GGGGGAGAGAGAGAGAGAGAGGGCGCGAAGA	1	312	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	282	0.0000%
ACGGGAAGGCCCGGTGGGGAAA	1	219	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	1	187	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	160	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACGCACTACCAGATCTGG	1	123	0.0000%
GATCGGAAGAGCACACGTCTGACTCCAGTCACGCACTACCAGATCTGGGG	1	121	0.0000%
CACGGGAAGGCCCGGTGGGGAAA	1	116	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGA	1	106	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACGCACTACCAGATCTGGGG	1	103	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER_SAME_GENE	awk	`filter same-gene (gene1==gene2)`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION_CRAM	samtools	`1.17`
SAMTOOLS_SORT_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_STARFUSION	samtools	`1.17`
SEQTK_SAMPLE	seqtk	`1.4.post122`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_FOR_ARRIBA	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
STAR_FOR_STARFUSION	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0002/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-095416' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,debugging -name dev_rna_exp0002_5f1fa79 --input 's3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260204_LH00166_0237_A23LGNLLT4__497a58ff--20260211-215120/samplesheets/rnaseq_samplesheetdev_rna_exp0002.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0002/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-095416' -resume c43312e0-42cf-4b97-93cd-1acabed4ece6

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0002_5f1fa79
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,debugging
configFiles: N/A

Input/output options

input: s3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260204_LH00166_0237_A23LGNLLT4__497a58ff--20260211-215120/samplesheets/rnaseq_samplesheetdev_rna_exp0002.csv
outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0002/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-095416
strand: unknown
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks