MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-05, 01:50 UTC based on data in: /tmp/nxf.ovom0UHAC6

General Statistics

Showing ²⁴⁰/₂₄₀ rows and ⁴⁹/₅₆ columns.

Sample Name	Total Reads	Expected Distinct	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Unique Reads	Frac Dupes	Frac Reads On Target	Frac Reads Off Target	N Q30	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
HD789_0002_RNA_0008_23H5VFLT4_s19	9999000000	446877146	Yes	64.98%	197826188	0.01	153111298	0.23	1	0	0.98	314.89	124.00	1	1	0.000	175.1bp	159.0bp	0.11%	1.14%	0.56%	0.00%	0.21%	3.34%	0.79%	0.00%				255bp	700bp	22.7%	0.0%	94.6%	89.5%	96.1%	95.0M	15.7%	97.6%	26749.0Mb	197.8M	54.7%	98.9%	36.8%
HD789_0002_RNA_0008_23H5VFLT4_s19_1																											175.1bp	94.7%	93.7M																69.8%	54%	151bp	151bp	27%	100.0M
HD789_0002_RNA_0008_23H5VFLT4_s19_2																																													70.2%	55%	151bp	151bp	18%	100.0M
HD789_0002_RNA_0008_23H5VFLT4_s19_trimmed_1																																													69.8%	54%	139bp	151bp	18%	98.9M	69.8%	54%	139bp	151bp	18%	98.9M
HD789_0002_RNA_0008_23H5VFLT4_s19_trimmed_2																																													70.8%	55%	139bp	151bp	9%	98.9M	70.8%	55%	139bp	151bp	9%	98.9M
NTC_0001_0001_23H5VFLT4_s15	9999000000	34935	Yes	100.00%	72882	0.36	42197	0.42	0	0	0.92	0.00	0.00	0	0	0.000	32.9bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%				24bp	27bp	66.3%	2.4%	4.3%	2.4%	9.7%	0.0M	43.6%	89.6%	4.3Mb	0.1M	67.9%	17.6%	56.0%
NTC_0001_0001_23H5VFLT4_s15_1																											32.9bp	3.3%	0.0M																89.4%	73%	151bp	151bp	55%	0.2M
NTC_0001_0001_23H5VFLT4_s15_2																																													88.1%	93%	151bp	151bp	55%	0.2M
NTC_0001_0001_23H5VFLT4_s15_trimmed_1																																													51.0%	65%	64bp	37bp	36%	0.0M	51.0%	65%	64bp	37bp	36%	0.0M
NTC_0001_0001_23H5VFLT4_s15_trimmed_2																																													53.1%	70%	66bp	37bp	45%	0.0M	53.1%	70%	66bp	37bp	45%	0.0M
V4_0001_RNA_0001_23H5VFLT4_s13	9999000000	350423638	No	0.00%	197837558	0.01	142950755	0.28	1	0	0.98	274.94	62.00	1	0	0.000	162.9bp	150.0bp	0.10%	1.16%	0.99%	0.00%	0.19%	3.21%	1.35%	0.00%				212bp	526bp	27.9%	0.0%	93.7%	89.3%	95.9%	94.8M	18.1%	97.6%	26320.5Mb	197.8M	54.6%	98.9%	43.4%
V4_0001_RNA_0001_23H5VFLT4_s13_1																											162.9bp	93.3%	92.3M																70.0%	54%	151bp	151bp	27%	100.0M
V4_0001_RNA_0001_23H5VFLT4_s13_2																																													70.6%	54%	151bp	151bp	18%	100.0M
V4_0001_RNA_0001_23H5VFLT4_s13_trimmed_1																																													70.1%	54%	136bp	151bp	18%	98.9M	70.1%	54%	136bp	151bp	18%	98.9M
V4_0001_RNA_0001_23H5VFLT4_s13_trimmed_2																																													71.2%	54%	136bp	151bp	9%	98.9M	71.2%	54%	136bp	151bp	9%	98.9M
tih_rna_sample_00087_23H5VFLT4_s17	9999000000	555810922	No	0.00%	198296386	0.01	154943588	0.22	1	0	0.98	266.22	116.00	1	1	0.000	147.8bp	137.0bp	0.15%	1.17%	0.50%	0.00%	0.35%	3.65%	0.70%	0.00%				162bp	315bp	22.0%	0.0%	90.8%	89.0%	95.6%	94.8M	13.6%	97.7%	25421.0Mb	198.3M	52.5%	99.1%	53.1%
tih_rna_sample_00087_23H5VFLT4_s17_1																											147.8bp	91.5%	90.7M																67.0%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00087_23H5VFLT4_s17_2																																													66.0%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00087_23H5VFLT4_s17_trimmed_1																																													67.0%	52%	131bp	147bp	18%	99.1M	67.0%	52%	131bp	147bp	18%	99.1M
tih_rna_sample_00087_23H5VFLT4_s17_trimmed_2																																													66.4%	52%	131bp	147bp	9%	99.1M	66.4%	52%	131bp	147bp	9%	99.1M
tih_rna_sample_00088_23H5VFLT4_s02	9999000000	290436403	No	0.00%	197537146	0.01	127522390	0.35	1	0	0.98	211.06	91.00	1	0	0.000	138.1bp	129.0bp	0.05%	0.35%	0.32%	0.00%	0.12%	1.22%	0.55%	0.00%				163bp	306bp	35.7%	0.0%	93.5%	88.2%	95.5%	94.3M	19.8%	97.5%	24561.1Mb	197.5M	58.3%	98.8%	60.5%
tih_rna_sample_00088_23H5VFLT4_s02_1																											138.1bp	93.8%	92.7M																67.2%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00088_23H5VFLT4_s02_2																																													66.8%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00088_23H5VFLT4_s02_trimmed_1																																													67.2%	58%	128bp	137bp	27%	98.8M	67.2%	58%	128bp	137bp	27%	98.8M
tih_rna_sample_00088_23H5VFLT4_s02_trimmed_2																																													67.5%	58%	128bp	137bp	18%	98.8M	67.5%	58%	128bp	137bp	18%	98.8M
tih_rna_sample_00089_23H5VFLT4_s39	9999000000	395803812	No	0.00%	197922900	0.01	146493904	0.26	1	0	0.98	261.09	116.00	1	1	0.000	149.2bp	139.0bp	0.18%	0.98%	0.49%	0.00%	0.40%	3.02%	0.73%	0.00%				175bp	376bp	26.2%	0.0%	93.3%	88.6%	95.6%	94.6M	16.7%	97.6%	25560.1Mb	197.9M	55.4%	99.0%	52.3%
tih_rna_sample_00089_23H5VFLT4_s39_1																											149.2bp	93.8%	92.8M																69.1%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00089_23H5VFLT4_s39_2																																													68.4%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00089_23H5VFLT4_s39_trimmed_1																																													69.1%	55%	132bp	147bp	18%	99.0M	69.1%	55%	132bp	147bp	18%	99.0M
tih_rna_sample_00089_23H5VFLT4_s39_trimmed_2																																													69.0%	55%	132bp	147bp	9%	99.0M	69.0%	55%	132bp	147bp	9%	99.0M
tih_rna_sample_00090_23H5VFLT4_s32	9999000000	297356977	No	0.00%	197406114	0.02	134366675	0.32	1	0	0.98	200.64	53.00	1	0	0.000	126.0bp	120.0bp	0.09%	0.91%	0.51%	0.00%	0.18%	2.57%	0.72%	0.00%				131bp	201bp	32.5%	0.0%	93.9%	82.6%	92.9%	91.7M	16.4%	97.4%	23276.3Mb	197.4M	59.7%	98.7%	71.3%
tih_rna_sample_00090_23H5VFLT4_s32_1																											126.0bp	93.2%	92.0M																67.4%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00090_23H5VFLT4_s32_2																																													67.7%	58%	151bp	151bp	36%	100.0M
tih_rna_sample_00090_23H5VFLT4_s32_trimmed_1																																													67.4%	59%	121bp	122bp	18%	98.7M	67.4%	59%	121bp	122bp	18%	98.7M
tih_rna_sample_00090_23H5VFLT4_s32_trimmed_2																																													68.3%	59%	121bp	127bp	9%	98.7M	68.3%	59%	121bp	127bp	9%	98.7M
tih_rna_sample_00096_23H5VFLT4_s11	9990000000	393640518	No	0.00%	198054442	0.01	148668046	0.25	1	0	0.98	252.86	120.00	1	1	0.000	145.0bp	136.0bp	0.21%	0.53%	0.29%	0.00%	0.44%	1.65%	0.42%	0.00%				156bp	283bp	25.1%	0.0%	91.8%	89.8%	96.0%	95.1M	15.8%	97.7%	25238.7Mb	198.1M	54.5%	99.0%	55.1%
tih_rna_sample_00096_23H5VFLT4_s11_1																											145.0bp	92.2%	91.3M																66.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00096_23H5VFLT4_s11_2																																													65.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00096_23H5VFLT4_s11_trimmed_1																																													66.2%	54%	130bp	142bp	18%	99.0M	66.2%	54%	130bp	142bp	18%	99.0M
tih_rna_sample_00096_23H5VFLT4_s11_trimmed_2																																													65.8%	54%	130bp	142bp	9%	99.0M	65.8%	54%	130bp	142bp	9%	99.0M
tih_rna_sample_00097_23H5VFLT4_s12	9999000000	362740208	No	0.00%	198138672	0.01	140214562	0.29	1	0	0.98	218.67	90.00	1	0	0.000	131.4bp	124.0bp	0.25%	1.79%	0.64%	0.00%	0.47%	4.91%	0.87%	0.00%				143bp	292bp	29.4%	0.0%	92.6%	87.8%	95.3%	94.4M	16.2%	97.6%	24048.7Mb	198.1M	52.5%	99.1%	66.6%
tih_rna_sample_00097_23H5VFLT4_s12_1																											131.4bp	92.5%	91.7M																68.2%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00097_23H5VFLT4_s12_2																																													67.2%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00097_23H5VFLT4_s12_trimmed_1																																													68.3%	52%	124bp	132bp	18%	99.1M	68.3%	52%	124bp	132bp	18%	99.1M
tih_rna_sample_00097_23H5VFLT4_s12_trimmed_2																																													67.7%	52%	124bp	132bp	9%	99.1M	67.7%	52%	124bp	132bp	9%	99.1M
tih_rna_sample_00104_23H5VFLT4_s20	9999000000	120456628	No	0.00%	196523650	0.02	69503176	0.65	1	0	0.98	69.50	24.00	0	0	0.000	117.8bp	114.0bp	0.27%	0.60%	0.28%	0.00%	0.56%	1.83%	0.42%	0.00%				118bp	148bp	65.9%	0.0%	90.1%	81.3%	92.7%	91.1M	37.7%	97.4%	22218.6Mb	196.5M	58.8%	98.3%	79.9%
tih_rna_sample_00104_23H5VFLT4_s20_1																											117.8bp	89.1%	87.5M																72.2%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00104_23H5VFLT4_s20_2																																													70.9%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00104_23H5VFLT4_s20_trimmed_1																																													72.2%	58%	116bp	117bp	18%	98.3M	72.2%	58%	116bp	117bp	18%	98.3M
tih_rna_sample_00104_23H5VFLT4_s20_trimmed_2																																													71.6%	58%	116bp	117bp	9%	98.3M	71.6%	58%	116bp	117bp	9%	98.3M
tih_rna_sample_00105_23H5VFLT4_s21	9999000000	62032855	No	0.00%	110239562	0.02	39523338	0.64	0	1	0.98	21.61	8.00	0	0	0.000	102.6bp	100.0bp	0.23%	0.48%	0.27%	0.00%	0.49%	1.50%	0.39%	0.00%				101bp	113bp	65.5%	0.0%	79.8%	78.7%	91.5%	50.4M	31.5%	97.6%	11139.4Mb	110.2M	53.6%	97.2%	89.4%
tih_rna_sample_00105_23H5VFLT4_s21_1																											102.6bp	79.2%	43.7M																67.9%	53%	151bp	151bp	36%	56.7M
tih_rna_sample_00105_23H5VFLT4_s21_2																																													66.5%	54%	151bp	151bp	45%	56.7M
tih_rna_sample_00105_23H5VFLT4_s21_trimmed_1																																													67.3%	53%	104bp	102bp	18%	55.1M	67.3%	53%	104bp	102bp	18%	55.1M
tih_rna_sample_00105_23H5VFLT4_s21_trimmed_2																																													66.5%	53%	104bp	102bp	9%	55.1M	66.5%	53%	104bp	102bp	9%	55.1M
tih_rna_sample_00111_23H5VFLT4_s30	9999000000	111958950	No	0.00%	197216116	0.01	70997766	0.64	1	0	0.98	68.87	31.00	1	0	0.000	127.4bp	121.0bp	0.09%	0.68%	0.21%	0.00%	0.21%	2.22%	0.34%	0.00%				127bp	159bp	65.0%	0.0%	86.3%	84.7%	93.9%	92.6M	42.1%	97.5%	23651.2Mb	197.2M	55.2%	98.6%	71.2%
tih_rna_sample_00111_23H5VFLT4_s30_1																											127.4bp	86.4%	85.2M																72.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00111_23H5VFLT4_s30_2																																													70.5%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00111_23H5VFLT4_s30_trimmed_1																																													72.0%	55%	123bp	127bp	18%	98.6M	72.0%	55%	123bp	127bp	18%	98.6M
tih_rna_sample_00111_23H5VFLT4_s30_trimmed_2																																													71.1%	55%	123bp	127bp	9%	98.6M	71.1%	55%	123bp	127bp	9%	98.6M
tih_rna_sample_00115_23H5VFLT4_s35	9999000000	191046880	No	0.00%	197596152	0.01	95129606	0.52	1	0	0.98	108.43	49.00	1	0	0.000	114.2bp	109.0bp	0.12%	0.34%	0.38%	0.00%	0.27%	1.13%	0.58%	0.00%				116bp	156bp	52.5%	0.0%	89.8%	85.6%	94.4%	93.3M	28.0%	97.6%	21845.4Mb	197.6M	55.5%	98.8%	81.2%
tih_rna_sample_00115_23H5VFLT4_s35_1																											114.2bp	89.7%	88.6M																68.1%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00115_23H5VFLT4_s35_2																																													66.8%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00115_23H5VFLT4_s35_trimmed_1																																													68.0%	55%	113bp	112bp	18%	98.8M	68.0%	55%	113bp	112bp	18%	98.8M
tih_rna_sample_00115_23H5VFLT4_s35_trimmed_2																																													67.3%	55%	113bp	112bp	9%	98.8M	67.3%	55%	113bp	112bp	9%	98.8M
tih_rna_sample_00116_23H5VFLT4_s36	9990000000	271724411	No	0.00%	197627826	0.01	131267082	0.34	1	0	0.98	190.32	82.00	1	0	0.000	123.6bp	117.0bp	0.18%	0.98%	0.62%	0.00%	0.32%	2.75%	0.83%	0.00%				125bp	201bp	33.9%	0.0%	93.0%	87.6%	95.1%	93.9M	17.1%	97.6%	23034.7Mb	197.6M	55.0%	98.8%	74.0%
tih_rna_sample_00116_23H5VFLT4_s36_1																											123.6bp	92.5%	91.4M																68.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00116_23H5VFLT4_s36_2																																													66.9%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00116_23H5VFLT4_s36_trimmed_1																																													68.0%	54%	119bp	122bp	18%	98.8M	68.0%	54%	119bp	122bp	18%	98.8M
tih_rna_sample_00116_23H5VFLT4_s36_trimmed_2																																													67.5%	55%	119bp	122bp	9%	98.8M	67.5%	55%	119bp	122bp	9%	98.8M
tih_rna_sample_00117_23H5VFLT4_s37	9990000000	107263619	No	0.00%	197137296	0.01	66860148	0.66	1	0	0.98	81.53	38.00	1	0	0.000	131.9bp	125.0bp	0.13%	0.48%	0.33%	0.00%	0.27%	1.59%	0.51%	0.00%				137bp	210bp	66.7%	0.0%	91.0%	87.0%	95.1%	93.7M	42.6%	97.6%	23992.6Mb	197.1M	55.9%	98.6%	67.0%
tih_rna_sample_00117_23H5VFLT4_s37_1																											131.9bp	90.9%	89.6M																75.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00117_23H5VFLT4_s37_2																																													73.4%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00117_23H5VFLT4_s37_trimmed_1																																													75.0%	55%	125bp	132bp	18%	98.6M	75.0%	55%	125bp	132bp	18%	98.6M
tih_rna_sample_00117_23H5VFLT4_s37_trimmed_2																																													74.1%	56%	125bp	132bp	9%	98.6M	74.1%	56%	125bp	132bp	9%	98.6M
tih_rna_sample_00118_23H5VFLT4_s38	9999000000	379107067	No	0.00%	197828828	0.01	144241810	0.27	1	0	0.98	247.17	108.00	1	1	0.000	142.6bp	132.0bp	0.35%	1.42%	0.50%	0.00%	0.79%	4.22%	0.76%	0.00%				160bp	334bp	27.3%	0.0%	93.3%	88.4%	95.6%	94.6M	16.8%	97.7%	25012.0Mb	197.8M	54.7%	98.9%	57.3%
tih_rna_sample_00118_23H5VFLT4_s38_1																											142.6bp	93.4%	92.4M																69.4%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00118_23H5VFLT4_s38_2																																													68.5%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00118_23H5VFLT4_s38_trimmed_1																																													69.5%	54%	129bp	142bp	18%	98.9M	69.5%	54%	129bp	142bp	18%	98.9M
tih_rna_sample_00118_23H5VFLT4_s38_trimmed_2																																													69.0%	54%	129bp	142bp	9%	98.9M	69.0%	54%	129bp	142bp	9%	98.9M
tih_rna_sample_00121_23H5VFLT4_s41	9999000000	307062684	No	0.00%	197622042	0.01	132626238	0.33	1	0	0.98	192.69	91.00	1	0	0.000	129.9bp	122.0bp	0.17%	0.61%	0.32%	0.00%	0.40%	1.97%	0.50%	0.00%				136bp	211bp	33.2%	0.0%	89.8%	86.3%	94.7%	93.6M	18.1%	97.5%	23777.9Mb	197.6M	56.2%	98.8%	66.7%
tih_rna_sample_00121_23H5VFLT4_s41_1																											129.9bp	89.8%	88.7M																65.9%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00121_23H5VFLT4_s41_2																																													65.1%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00121_23H5VFLT4_s41_trimmed_1																																													65.9%	56%	123bp	127bp	27%	98.8M	65.9%	56%	123bp	127bp	27%	98.8M
tih_rna_sample_00121_23H5VFLT4_s41_trimmed_2																																													65.8%	56%	123bp	127bp	18%	98.8M	65.8%	56%	123bp	127bp	18%	98.8M
tih_rna_sample_00122_23H5VFLT4_s42	9999000000	238356444	No	0.00%	197620846	0.01	121390645	0.39	1	0	0.98	142.64	65.00	1	0	0.000	118.9bp	113.0bp	0.30%	0.86%	0.32%	0.00%	0.62%	2.63%	0.47%	0.00%				117bp	148bp	39.0%	0.0%	85.7%	84.9%	94.3%	93.2M	20.8%	97.7%	22478.6Mb	197.6M	52.8%	98.8%	77.4%
tih_rna_sample_00122_23H5VFLT4_s42_1																											118.9bp	86.1%	85.1M																61.4%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00122_23H5VFLT4_s42_2																																													60.5%	53%	151bp	151bp	36%	100.0M
tih_rna_sample_00122_23H5VFLT4_s42_trimmed_1																																													61.4%	52%	116bp	117bp	18%	98.8M	61.4%	52%	116bp	117bp	18%	98.8M
tih_rna_sample_00122_23H5VFLT4_s42_trimmed_2																																													60.9%	52%	116bp	117bp	9%	98.8M	60.9%	52%	116bp	117bp	9%	98.8M
tih_rna_sample_00124_23H5VFLT4_s31	9999000000	400403026	No	0.00%	197936714	0.01	145108108	0.27	1	0	0.98	248.44	128.00	1	1	0.000	147.0bp	136.0bp	0.10%	0.70%	0.37%	0.00%	0.23%	2.28%	0.58%	0.00%				170bp	346bp	26.9%	0.0%	91.6%	90.0%	95.7%	94.7M	16.4%	97.7%	25298.7Mb	197.9M	53.8%	99.0%	54.0%
tih_rna_sample_00124_23H5VFLT4_s31_1																											147.0bp	91.9%	91.0M																65.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00124_23H5VFLT4_s31_2																																													65.1%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00124_23H5VFLT4_s31_trimmed_1																																													65.4%	53%	131bp	147bp	18%	99.0M	65.4%	53%	131bp	147bp	18%	99.0M
tih_rna_sample_00124_23H5VFLT4_s31_trimmed_2																																													65.5%	54%	131bp	147bp	9%	99.0M	65.5%	54%	131bp	147bp	9%	99.0M
tih_rna_sample_00127_23H5VFLT4_s08	9999000000	225968885	No	0.00%	197688908	0.01	123354754	0.38	1	0	0.98	166.65	83.00	1	0	0.000	122.0bp	115.0bp	0.20%	1.01%	0.36%	0.00%	0.42%	3.08%	0.54%	0.00%				123bp	183bp	37.9%	0.0%	90.3%	86.9%	94.9%	93.8M	19.6%	97.7%	22893.4Mb	197.7M	53.9%	98.8%	74.2%
tih_rna_sample_00127_23H5VFLT4_s08_1																											122.0bp	90.4%	89.3M																64.1%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00127_23H5VFLT4_s08_2																																													62.5%	53%	151bp	151bp	36%	100.0M
tih_rna_sample_00127_23H5VFLT4_s08_trimmed_1																																													64.0%	53%	118bp	122bp	18%	98.8M	64.0%	53%	118bp	122bp	18%	98.8M
tih_rna_sample_00127_23H5VFLT4_s08_trimmed_2																																													62.9%	54%	119bp	122bp	9%	98.8M	62.9%	54%	119bp	122bp	9%	98.8M
tih_rna_sample_00163_23H5VFLT4_s43	9999000000	381504399	No	0.00%	198051138	0.01	142463729	0.28	1	0	0.98	237.02	113.00	1	1	0.000	141.5bp	130.0bp	0.21%	0.99%	0.38%	0.00%	0.44%	3.09%	0.57%	0.00%				155bp	299bp	28.2%	0.0%	91.8%	89.7%	96.0%	95.0M	17.0%	97.7%	24872.9Mb	198.1M	53.6%	99.0%	57.9%
tih_rna_sample_00163_23H5VFLT4_s43_1																											141.5bp	92.2%	91.3M																68.9%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00163_23H5VFLT4_s43_2																																													67.2%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00163_23H5VFLT4_s43_trimmed_1																																													68.9%	53%	128bp	137bp	18%	99.0M	68.9%	53%	128bp	137bp	18%	99.0M
tih_rna_sample_00163_23H5VFLT4_s43_trimmed_2																																													67.7%	53%	129bp	137bp	9%	99.0M	67.7%	53%	129bp	137bp	9%	99.0M
tih_rna_sample_00218_23H5VFLT4_s10	9999000000	445195846	No	0.00%	198257286	0.01	143871130	0.27	1	0	0.98	258.94	110.00	1	1	0.000	147.0bp	136.0bp	0.15%	0.64%	0.44%	0.00%	0.33%	2.10%	0.67%	0.00%				175bp	427bp	27.6%	0.0%	94.7%	90.2%	96.1%	95.3M	16.9%	97.8%	25393.7Mb	198.3M	53.8%	99.1%	53.8%
tih_rna_sample_00218_23H5VFLT4_s10_1																											147.0bp	94.8%	94.0M																70.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00218_23H5VFLT4_s10_2																																													69.1%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00218_23H5VFLT4_s10_trimmed_1																																													70.0%	53%	131bp	147bp	18%	99.1M	70.0%	53%	131bp	147bp	18%	99.1M
tih_rna_sample_00218_23H5VFLT4_s10_trimmed_2																																													69.6%	54%	131bp	147bp	9%	99.1M	69.6%	54%	131bp	147bp	9%	99.1M
tih_rna_sample_00220_23H5VFLT4_s16	9999000000	199632375	No	0.00%	197979250	0.01	111682668	0.44	1	0	0.98	175.83	79.00	1	0	0.000	141.2bp	132.0bp	0.11%	0.57%	0.26%	0.00%	0.24%	1.95%	0.42%	0.00%				155bp	270bp	43.9%	0.0%	92.0%	88.9%	95.6%	94.7M	27.0%	97.6%	24953.4Mb	198.0M	56.7%	99.0%	59.2%
tih_rna_sample_00220_23H5VFLT4_s16_1																											141.2bp	92.3%	91.3M																67.3%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00220_23H5VFLT4_s16_2																																													66.5%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00220_23H5VFLT4_s16_trimmed_1																																													67.3%	56%	129bp	137bp	27%	99.0M	67.3%	56%	129bp	137bp	27%	99.0M
tih_rna_sample_00220_23H5VFLT4_s16_trimmed_2																																													67.0%	56%	129bp	137bp	9%	99.0M	67.0%	56%	129bp	137bp	9%	99.0M
tih_rna_sample_00235_23H5VFLT4_s07	9999000000	540123051	No	0.00%	198109250	0.01	152970753	0.23	1	0	0.98	271.33	128.00	1	1	0.000	148.0bp	137.0bp	0.11%	0.88%	0.32%	0.00%	0.23%	2.62%	0.50%	0.00%				170bp	370bp	22.9%	0.0%	93.4%	89.4%	95.8%	94.8M	13.9%	97.7%	25386.1Mb	198.1M	54.0%	99.1%	53.6%
tih_rna_sample_00235_23H5VFLT4_s07_1																											148.0bp	93.4%	92.5M																67.5%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00235_23H5VFLT4_s07_2																																													66.7%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00235_23H5VFLT4_s07_trimmed_1																																													67.5%	53%	131bp	147bp	18%	99.1M	67.5%	53%	131bp	147bp	18%	99.1M
tih_rna_sample_00235_23H5VFLT4_s07_trimmed_2																																													67.2%	54%	131bp	147bp	9%	99.1M	67.2%	54%	131bp	147bp	9%	99.1M
tih_rna_sample_00248_23H5VFLT4_s01	9999000000	352546802	No	0.00%	197923118	0.01	144245295	0.27	1	0	0.98	231.91	103.00	1	1	0.000	138.1bp	128.0bp	0.19%	0.96%	0.35%	0.00%	0.38%	2.95%	0.54%	0.00%				144bp	251bp	27.4%	0.0%	92.0%	88.1%	95.1%	94.1M	15.0%	97.6%	24550.0Mb	197.9M	54.2%	99.0%	61.5%
tih_rna_sample_00248_23H5VFLT4_s01_1																											138.1bp	92.3%	91.3M																63.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00248_23H5VFLT4_s01_2																																													62.5%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00248_23H5VFLT4_s01_trimmed_1																																													63.3%	54%	127bp	137bp	18%	99.0M	63.3%	54%	127bp	137bp	18%	99.0M
tih_rna_sample_00248_23H5VFLT4_s01_trimmed_2																																													63.0%	54%	127bp	137bp	9%	99.0M	63.0%	54%	127bp	137bp	9%	99.0M
tih_rna_sample_00251_23H5VFLT4_s03	9999000000	304642484	No	0.00%	197696920	0.01	138096671	0.30	1	0	0.98	224.10	98.00	1	0	0.000	143.4bp	134.0bp	0.27%	1.06%	0.36%	0.00%	0.59%	3.30%	0.56%	0.00%				148bp	243bp	30.4%	0.0%	90.8%	87.0%	95.2%	94.0M	19.3%	97.7%	24964.1Mb	197.7M	54.6%	98.8%	57.4%
tih_rna_sample_00251_23H5VFLT4_s03_1																											143.4bp	90.9%	89.9M																67.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00251_23H5VFLT4_s03_2																																													66.6%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00251_23H5VFLT4_s03_trimmed_1																																													67.2%	54%	129bp	142bp	18%	98.8M	67.2%	54%	129bp	142bp	18%	98.8M
tih_rna_sample_00251_23H5VFLT4_s03_trimmed_2																																													67.2%	54%	129bp	142bp	9%	98.8M	67.2%	54%	129bp	142bp	9%	98.8M
tih_rna_sample_00252_23H5VFLT4_s04	9999000000	230853292	No	0.00%	197594884	0.01	127942507	0.35	1	0	0.98	215.98	109.00	1	1	0.000	147.0bp	136.0bp	0.07%	0.60%	0.31%	0.00%	0.15%	1.89%	0.47%	0.00%				158bp	294bp	35.5%	0.0%	92.5%	88.7%	95.6%	94.5M	22.5%	97.6%	25274.9Mb	197.6M	55.2%	98.8%	54.5%
tih_rna_sample_00252_23H5VFLT4_s04_1																											147.0bp	92.8%	91.7M																66.7%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00252_23H5VFLT4_s04_2																																													65.6%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00252_23H5VFLT4_s04_trimmed_1																																													66.6%	54%	131bp	142bp	18%	98.8M	66.6%	54%	131bp	142bp	18%	98.8M
tih_rna_sample_00252_23H5VFLT4_s04_trimmed_2																																													66.1%	55%	131bp	142bp	9%	98.8M	66.1%	55%	131bp	142bp	9%	98.8M
tih_rna_sample_00254_23H5VFLT4_s05	9999000000	243093507	No	0.00%	197265522	0.02	127594403	0.35	1	0	0.98	192.65	74.00	1	0	0.000	126.8bp	120.0bp	0.43%	0.87%	0.50%	0.00%	0.90%	2.56%	0.73%	0.00%				132bp	216bp	36.0%	0.0%	94.9%	84.2%	93.3%	92.0M	18.8%	97.5%	23370.7Mb	197.3M	58.3%	98.6%	71.0%
tih_rna_sample_00254_23H5VFLT4_s05_1																											126.8bp	94.4%	93.1M																67.0%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00254_23H5VFLT4_s05_2																																													66.9%	57%	151bp	151bp	18%	100.0M
tih_rna_sample_00254_23H5VFLT4_s05_trimmed_1																																													67.0%	58%	121bp	127bp	18%	98.6M	67.0%	58%	121bp	127bp	18%	98.6M
tih_rna_sample_00254_23H5VFLT4_s05_trimmed_2																																													67.5%	58%	122bp	127bp	9%	98.6M	67.5%	58%	122bp	127bp	9%	98.6M
tih_rna_sample_00261_23H5VFLT4_s06	9999000000	251140240	No	0.00%	197414914	0.01	122338986	0.38	1	0	0.97	190.61	88.00	1	0	0.000	142.9bp	133.0bp	0.14%	0.39%	0.24%	0.00%	0.32%	1.30%	0.39%	0.00%				146bp	224bp	38.4%	0.0%	90.4%	85.1%	94.7%	93.4M	23.9%	97.3%	24800.4Mb	197.4M	56.7%	98.7%	58.3%
tih_rna_sample_00261_23H5VFLT4_s06_1																											142.9bp	90.8%	89.6M																66.8%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00261_23H5VFLT4_s06_2																																													66.3%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00261_23H5VFLT4_s06_trimmed_1																																													66.8%	56%	129bp	137bp	18%	98.7M	66.8%	56%	129bp	137bp	18%	98.7M
tih_rna_sample_00261_23H5VFLT4_s06_trimmed_2																																													66.9%	56%	129bp	142bp	9%	98.7M	66.9%	56%	129bp	142bp	9%	98.7M
tih_rna_sample_00272_23H5VFLT4_s09	9999000000	350038460	No	0.00%	197913500	0.01	140007906	0.29	1	0	0.98	240.65	116.00	1	1	0.000	145.1bp	135.0bp	0.22%	0.47%	0.28%	0.00%	0.48%	1.54%	0.44%	0.00%				167bp	345bp	29.4%	0.0%	92.8%	90.0%	96.1%	95.1M	18.3%	97.7%	25177.2Mb	197.9M	54.6%	99.0%	55.7%
tih_rna_sample_00272_23H5VFLT4_s09_1																											145.1bp	93.1%	92.2M																68.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00272_23H5VFLT4_s09_2																																													67.2%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00272_23H5VFLT4_s09_trimmed_1																																													68.0%	54%	130bp	142bp	18%	99.0M	68.0%	54%	130bp	142bp	18%	99.0M
tih_rna_sample_00272_23H5VFLT4_s09_trimmed_2																																													67.8%	54%	130bp	142bp	9%	99.0M	67.8%	54%	130bp	142bp	9%	99.0M
tih_rna_sample_00274_23H5VFLT4_s14	9999000000	190877061	No	0.00%	197421078	0.01	108541413	0.45	1	0	0.98	125.72	61.00	1	0	0.000	120.4bp	115.0bp	0.10%	0.79%	0.35%	0.00%	0.21%	2.42%	0.49%	0.00%				119bp	151bp	45.4%	0.0%	86.5%	85.7%	94.4%	93.2M	25.2%	97.6%	22686.4Mb	197.4M	53.3%	98.7%	77.0%
tih_rna_sample_00274_23H5VFLT4_s14_1																											120.4bp	87.0%	85.9M																64.0%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00274_23H5VFLT4_s14_2																																													62.4%	53%	151bp	151bp	36%	100.0M
tih_rna_sample_00274_23H5VFLT4_s14_trimmed_1																																													63.9%	53%	118bp	117bp	18%	98.7M	63.9%	53%	118bp	117bp	18%	98.7M
tih_rna_sample_00274_23H5VFLT4_s14_trimmed_2																																													63.0%	53%	118bp	122bp	9%	98.7M	63.0%	53%	118bp	122bp	9%	98.7M
tih_rna_sample_00280_23H5VFLT4_s18	9999000000	494433051	No	0.00%	198051450	0.01	153273902	0.23	1	0	0.98	286.88	123.00	1	1	0.000	155.8bp	143.0bp	0.13%	0.52%	0.45%	0.00%	0.29%	1.63%	0.66%	0.00%				192bp	431bp	22.9%	0.0%	93.9%	86.9%	94.6%	93.7M	14.8%	97.6%	25977.9Mb	198.1M	55.5%	99.0%	47.3%
tih_rna_sample_00280_23H5VFLT4_s18_1																											155.8bp	94.2%	93.3M																68.3%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00280_23H5VFLT4_s18_2																																													67.9%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00280_23H5VFLT4_s18_trimmed_1																																													68.3%	55%	134bp	151bp	18%	99.0M	68.3%	55%	134bp	151bp	18%	99.0M
tih_rna_sample_00280_23H5VFLT4_s18_trimmed_2																																													68.5%	55%	134bp	151bp	9%	99.0M	68.5%	55%	134bp	151bp	9%	99.0M
tih_rna_sample_00377_23H5VFLT4_s23	9999000000	269488938	No	0.00%	197788884	0.01	128147309	0.35	1	0	0.98	216.67	88.00	1	0	0.000	139.6bp	130.0bp	0.16%	0.59%	0.36%	0.00%	0.38%	1.84%	0.55%	0.00%				156bp	322bp	35.7%	0.0%	94.8%	84.2%	93.4%	92.4M	20.3%	97.6%	24864.3Mb	197.8M	54.6%	98.9%	59.0%
tih_rna_sample_00377_23H5VFLT4_s23_1																											139.6bp	94.5%	93.5M																69.9%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00377_23H5VFLT4_s23_2																																													67.4%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00377_23H5VFLT4_s23_trimmed_1																																													70.0%	54%	129bp	137bp	18%	98.9M	70.0%	54%	129bp	137bp	18%	98.9M
tih_rna_sample_00377_23H5VFLT4_s23_trimmed_2																																													68.0%	54%	129bp	137bp	18%	98.9M	68.0%	54%	129bp	137bp	18%	98.9M
tih_rna_sample_00378_23H5VFLT4_s24	9999000000	208164697	No	0.00%	197895464	0.01	119854884	0.39	1	0	0.98	147.83	71.00	1	0	0.000	119.2bp	113.0bp	0.22%	2.05%	0.61%	0.00%	0.39%	5.47%	0.81%	0.00%				118bp	164bp	39.7%	0.0%	88.2%	86.0%	94.7%	93.7M	21.5%	97.8%	22580.5Mb	197.9M	50.8%	98.9%	77.4%
tih_rna_sample_00378_23H5VFLT4_s24_1																											119.2bp	88.1%	87.2M																64.8%	50%	151bp	151bp	27%	100.0M
tih_rna_sample_00378_23H5VFLT4_s24_2																																													62.6%	51%	151bp	151bp	36%	100.0M
tih_rna_sample_00378_23H5VFLT4_s24_trimmed_1																																													64.7%	50%	117bp	117bp	18%	98.9M	64.7%	50%	117bp	117bp	18%	98.9M
tih_rna_sample_00378_23H5VFLT4_s24_trimmed_2																																													63.0%	50%	117bp	117bp	9%	98.9M	63.0%	50%	117bp	117bp	9%	98.9M
tih_rna_sample_00388_23H5VFLT4_s22	9999000000	523706785	No	0.00%	198169640	0.01	150928051	0.24	1	0	0.98	297.15	145.00	1	1	0.000	165.8bp	152.0bp	0.13%	0.56%	0.36%	0.00%	0.29%	1.93%	0.57%	0.00%				222bp	549bp	24.0%	0.0%	93.8%	90.0%	96.2%	95.4M	15.7%	97.6%	26509.1Mb	198.2M	54.7%	99.1%	41.1%
tih_rna_sample_00388_23H5VFLT4_s22_1																											165.8bp	94.2%	93.3M																68.6%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00388_23H5VFLT4_s22_2																																													67.9%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00388_23H5VFLT4_s22_trimmed_1																																													68.6%	54%	137bp	151bp	18%	99.1M	68.6%	54%	137bp	151bp	18%	99.1M
tih_rna_sample_00388_23H5VFLT4_s22_trimmed_2																																													68.4%	54%	137bp	151bp	9%	99.1M	68.4%	54%	137bp	151bp	9%	99.1M
tih_rna_sample_00394_23H5VFLT4_s25	9990000000	207442768	No	0.00%	197437912	0.01	112813529	0.43	1	0	0.98	143.00	69.00	1	0	0.000	126.3bp	120.0bp	0.17%	0.53%	0.28%	0.00%	0.40%	1.73%	0.43%	0.00%				125bp	167bp	43.4%	0.0%	87.6%	86.1%	94.5%	93.3M	25.6%	97.6%	23299.8Mb	197.4M	53.8%	98.7%	71.4%
tih_rna_sample_00394_23H5VFLT4_s25_1																											126.3bp	87.8%	86.6M																65.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00394_23H5VFLT4_s25_2																																													64.2%	53%	151bp	151bp	36%	100.0M
tih_rna_sample_00394_23H5VFLT4_s25_trimmed_1																																													65.3%	53%	121bp	122bp	18%	98.7M	65.3%	53%	121bp	122bp	18%	98.7M
tih_rna_sample_00394_23H5VFLT4_s25_trimmed_2																																													64.8%	53%	121bp	122bp	9%	98.7M	64.8%	53%	121bp	122bp	9%	98.7M
tih_rna_sample_00396_23H5VFLT4_s26	9999000000	552237090	No	0.00%	198066574	0.01	157266473	0.21	1	0	0.98	292.66	144.00	1	1	0.000	156.9bp	145.0bp	0.31%	1.00%	0.43%	0.00%	0.69%	3.10%	0.64%	0.00%				187bp	420bp	20.8%	0.0%	92.9%	89.0%	95.6%	94.7M	13.1%	97.7%	26028.4Mb	198.1M	54.1%	99.0%	46.7%
tih_rna_sample_00396_23H5VFLT4_s26_1																											156.9bp	93.2%	92.3M																66.5%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00396_23H5VFLT4_s26_2																																													65.7%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00396_23H5VFLT4_s26_trimmed_1																																													66.5%	53%	135bp	151bp	18%	99.0M	66.5%	53%	135bp	151bp	18%	99.0M
tih_rna_sample_00396_23H5VFLT4_s26_trimmed_2																																													66.2%	54%	135bp	151bp	9%	99.0M	66.2%	54%	135bp	151bp	9%	99.0M
tih_rna_sample_00400_23H5VFLT4_s27	9999000000	371957139	No	0.00%	197775310	0.02	143979173	0.27	1	0	0.98	230.72	112.00	1	1	0.000	133.1bp	126.0bp	0.20%	0.69%	0.39%	0.00%	0.42%	2.10%	0.56%	0.00%				140bp	246bp	27.6%	0.0%	93.4%	85.8%	94.0%	92.9M	15.3%	97.7%	24156.8Mb	197.8M	54.1%	98.9%	64.3%
tih_rna_sample_00400_23H5VFLT4_s27_1																											133.1bp	93.4%	92.3M																67.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00400_23H5VFLT4_s27_2																																													65.9%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00400_23H5VFLT4_s27_trimmed_1																																													67.2%	53%	125bp	132bp	18%	98.9M	67.2%	53%	125bp	132bp	18%	98.9M
tih_rna_sample_00400_23H5VFLT4_s27_trimmed_2																																													66.5%	54%	125bp	132bp	9%	98.9M	66.5%	54%	125bp	132bp	9%	98.9M
tih_rna_sample_00402_23H5VFLT4_s28	9999000000	497520113	No	0.00%	198177758	0.02	151474829	0.24	1	0	0.98	254.24	124.00	1	1	0.000	142.9bp	133.0bp	0.20%	1.12%	0.33%	0.00%	0.44%	3.56%	0.52%	0.00%				157bp	305bp	23.9%	0.0%	91.9%	87.8%	94.5%	93.7M	14.1%	97.6%	25061.3Mb	198.2M	53.1%	99.1%	56.7%
tih_rna_sample_00402_23H5VFLT4_s28_1																											142.9bp	92.5%	91.6M																66.6%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00402_23H5VFLT4_s28_2																																													65.4%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00402_23H5VFLT4_s28_trimmed_1																																													66.6%	52%	130bp	142bp	18%	99.1M	66.6%	52%	130bp	142bp	18%	99.1M
tih_rna_sample_00402_23H5VFLT4_s28_trimmed_2																																													65.9%	53%	130bp	142bp	9%	99.1M	65.9%	53%	130bp	142bp	9%	99.1M
tih_rna_sample_00403_23H5VFLT4_s29	9990000000	304882726	No	0.00%	197915996	0.01	136152981	0.31	1	0	0.98	210.50	92.00	1	0	0.000	133.9bp	126.0bp	0.19%	0.63%	0.36%	0.00%	0.41%	1.97%	0.52%	0.00%				136bp	211bp	31.4%	0.0%	91.2%	89.5%	95.7%	94.7M	18.0%	97.7%	24218.1Mb	197.9M	54.0%	99.0%	64.3%
tih_rna_sample_00403_23H5VFLT4_s29_1																											133.9bp	91.5%	90.6M																66.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00403_23H5VFLT4_s29_2																																													64.9%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00403_23H5VFLT4_s29_trimmed_1																																													66.0%	53%	125bp	132bp	18%	99.0M	66.0%	53%	125bp	132bp	18%	99.0M
tih_rna_sample_00403_23H5VFLT4_s29_trimmed_2																																													65.5%	54%	125bp	132bp	9%	99.0M	65.5%	54%	125bp	132bp	9%	99.0M
tih_rna_sample_00407_23H5VFLT4_s33	9999000000	177190537	No	0.00%	197377320	0.01	101341717	0.49	1	0	0.98	160.12	76.00	1	0	0.000	143.0bp	133.0bp	0.12%	0.52%	0.36%	0.00%	0.26%	1.64%	0.54%	0.00%				154bp	269bp	49.1%	0.0%	92.6%	86.3%	94.7%	93.5M	32.4%	97.5%	24879.4Mb	197.4M	56.9%	98.7%	57.0%
tih_rna_sample_00407_23H5VFLT4_s33_1																											143.0bp	92.3%	91.1M																72.6%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00407_23H5VFLT4_s33_2																																													71.8%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00407_23H5VFLT4_s33_trimmed_1																																													72.6%	56%	129bp	142bp	18%	98.7M	72.6%	56%	129bp	142bp	18%	98.7M
tih_rna_sample_00407_23H5VFLT4_s33_trimmed_2																																													72.6%	57%	129bp	142bp	9%	98.7M	72.6%	57%	129bp	142bp	9%	98.7M
tih_rna_sample_00410_23H5VFLT4_s34	9999000000	188951376	No	0.00%	197133378	0.01	105270623	0.47	1	0	0.98	146.51	70.00	1	0	0.000	132.3bp	124.0bp	0.05%	0.76%	0.40%	0.00%	0.10%	2.30%	0.60%	0.00%				135bp	211bp	47.0%	0.0%	90.3%	87.0%	95.1%	93.7M	29.7%	97.6%	23992.9Mb	197.1M	53.2%	98.6%	66.2%
tih_rna_sample_00410_23H5VFLT4_s34_1																											132.3bp	90.6%	89.3M																68.0%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00410_23H5VFLT4_s34_2																																													67.6%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00410_23H5VFLT4_s34_trimmed_1																																													67.9%	53%	125bp	132bp	18%	98.6M	67.9%	53%	125bp	132bp	18%	98.6M
tih_rna_sample_00410_23H5VFLT4_s34_trimmed_2																																													68.2%	53%	125bp	132bp	9%	98.6M	68.2%	53%	125bp	132bp	9%	98.6M
tih_rna_sample_00414_23H5VFLT4_s40	9999000000	436424116	No	0.00%	197880340	0.01	149792407	0.24	1	0	0.98	259.56	117.00	1	1	0.000	148.1bp	137.0bp	0.10%	0.76%	0.38%	0.00%	0.21%	2.35%	0.58%	0.00%				158bp	282bp	24.5%	0.0%	92.2%	86.8%	94.8%	93.8M	15.3%	97.6%	25227.9Mb	197.9M	56.3%	98.9%	54.2%
tih_rna_sample_00414_23H5VFLT4_s40_1																											148.1bp	92.5%	91.5M																67.4%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00414_23H5VFLT4_s40_2																																													67.2%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00414_23H5VFLT4_s40_trimmed_1																																													67.4%	56%	131bp	142bp	18%	98.9M	67.4%	56%	131bp	142bp	18%	98.9M
tih_rna_sample_00414_23H5VFLT4_s40_trimmed_2																																													67.7%	56%	131bp	142bp	9%	98.9M	67.7%	56%	131bp	142bp	9%	98.9M
tih_rna_sample_00419_23H5VFLT4_s44	9990000000	464317598	No	0.00%	197804040	0.01	152969046	0.23	1	0	0.98	275.47	121.00	1	1	0.000	149.3bp	137.0bp	0.23%	1.09%	0.49%	0.00%	0.50%	3.28%	0.72%	0.00%				168bp	355bp	22.8%	0.0%	93.5%	88.5%	95.6%	94.6M	13.7%	97.7%	25321.5Mb	197.8M	54.7%	98.9%	52.7%
tih_rna_sample_00419_23H5VFLT4_s44_1																											149.3bp	93.9%	92.9M																67.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00419_23H5VFLT4_s44_2																																													66.9%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00419_23H5VFLT4_s44_trimmed_1																																													67.5%	54%	131bp	147bp	18%	98.9M	67.5%	54%	131bp	147bp	18%	98.9M
tih_rna_sample_00419_23H5VFLT4_s44_trimmed_2																																													67.6%	54%	131bp	147bp	9%	98.9M	67.6%	54%	131bp	147bp	9%	98.9M
tih_rna_sample_00420_23H5VFLT4_s45	9999000000	109555853	No	0.00%	196546592	0.01	70891871	0.64	1	0	0.98	87.57	43.00	1	0	0.000	138.2bp	128.0bp	0.11%	0.28%	0.20%	0.00%	0.23%	0.92%	0.32%	0.00%				141bp	215bp	64.7%	0.0%	89.3%	84.7%	94.2%	92.5M	43.8%	97.5%	24300.0Mb	196.5M	55.7%	98.3%	61.5%
tih_rna_sample_00420_23H5VFLT4_s45_1																											138.2bp	89.9%	88.3M																75.4%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00420_23H5VFLT4_s45_2																																													73.7%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00420_23H5VFLT4_s45_trimmed_1																																													75.3%	55%	127bp	137bp	18%	98.3M	75.3%	55%	127bp	137bp	18%	98.3M
tih_rna_sample_00420_23H5VFLT4_s45_trimmed_2																																													74.4%	55%	127bp	137bp	9%	98.3M	74.4%	55%	127bp	137bp	9%	98.3M
tih_rna_sample_00422_23H5VFLT4_s47	9990000000	61292242	No	0.00%	169264240	0.02	46067067	0.73	0	0	0.98	30.61	12.00	0	0	0.000	109.1bp	105.0bp	0.46%	0.94%	0.35%	0.00%	0.94%	2.84%	0.52%	0.00%				107bp	130bp	74.1%	0.0%	85.9%	80.7%	92.6%	78.4M	40.1%	97.5%	17953.5Mb	169.3M	54.5%	97.0%	84.7%
tih_rna_sample_00422_23H5VFLT4_s47_1																											109.1bp	85.4%	72.3M																76.2%	53%	151bp	151bp	27%	87.2M
tih_rna_sample_00422_23H5VFLT4_s47_2																																													74.5%	55%	151bp	151bp	45%	87.2M
tih_rna_sample_00422_23H5VFLT4_s47_trimmed_1																																													75.8%	54%	109bp	107bp	18%	84.6M	75.8%	54%	109bp	107bp	18%	84.6M
tih_rna_sample_00422_23H5VFLT4_s47_trimmed_2																																													75.1%	54%	109bp	107bp	9%	84.6M	75.1%	54%	109bp	107bp	9%	84.6M
tih_rna_sample_00425_23H5VFLT4_s46	9999000000	151501619	No	0.00%	196494860	0.01	90097187	0.54	1	0	0.98	106.06	48.00	1	0	0.000	125.2bp	119.0bp	0.07%	0.53%	0.21%	0.00%	0.17%	1.79%	0.36%	0.00%				125bp	167bp	54.8%	0.0%	88.3%	84.6%	94.1%	92.5M	33.0%	97.4%	22990.6Mb	196.5M	56.7%	98.2%	72.4%
tih_rna_sample_00425_23H5VFLT4_s46_1																											125.2bp	88.3%	86.8M																71.0%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00425_23H5VFLT4_s46_2																																													69.7%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00425_23H5VFLT4_s46_trimmed_1																																													70.9%	56%	120bp	122bp	18%	98.2M	70.9%	56%	120bp	122bp	18%	98.2M
tih_rna_sample_00425_23H5VFLT4_s46_trimmed_2																																													70.4%	56%	120bp	122bp	9%	98.2M	70.4%	56%	120bp	122bp	9%	98.2M
tih_rna_sample_00426_23H5VFLT4_s48	9999000000	235757746	No	0.00%	196560954	0.02	116373397	0.41	1	0	0.98	185.76	73.00	1	0	0.000	143.4bp	132.0bp	0.22%	0.92%	0.27%	0.00%	0.46%	2.78%	0.44%	0.00%				150bp	242bp	41.4%	0.0%	91.6%	78.0%	92.2%	90.6M	26.7%	97.4%	24765.8Mb	196.6M	58.4%	98.3%	56.5%
tih_rna_sample_00426_23H5VFLT4_s48_1																											143.4bp	91.5%	89.9M																71.1%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00426_23H5VFLT4_s48_2																																													70.5%	57%	151bp	151bp	18%	100.0M
tih_rna_sample_00426_23H5VFLT4_s48_trimmed_1																																													71.1%	58%	129bp	142bp	18%	98.3M	71.1%	58%	129bp	142bp	18%	98.3M
tih_rna_sample_00426_23H5VFLT4_s48_trimmed_2																																													71.4%	58%	129bp	142bp	9%	98.3M	71.4%	58%	129bp	142bp	9%	98.3M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools	Reads	SeqTools Reads	`reads`	None
\|\|	Custom content: SeqTools	Frac Unmapped	SeqTools Frac Unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools	Unique Reads	SeqTools Unique Reads	`unique_reads`	None
\|\|	Custom content: SeqTools	Frac Dupes	SeqTools Frac Dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools	Frac Reads On Target	SeqTools Frac Reads On Target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools	Frac Reads Off Target	SeqTools Frac Reads Off Target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools	N Q30	SeqTools N Q30	`n_q30`	None
\|\|	Custom content: SeqTools	Mean Depth	SeqTools Mean Depth	`mean_depth`	None
\|\|	Custom content: SeqTools	Q50 Depth	SeqTools Q50 Depth	`q50_depth`	None
\|\|	Custom content: SeqTools	Frac Bases Gt30X	SeqTools Frac Bases Gt30X	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools	Frac Bases Gt100X	SeqTools Frac Bases Gt100X	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools	GC Bias	Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
HD789_0002_RNA_0008_23H5VFLT4_s19	213.3M	0.0M	0.0M	14.9M	1.2M	191.5M	95.8M	95.7M	95.8M	95.8M	93.0M	98.6M	191.0M	0.0M
NTC_0001_0001_23H5VFLT4_s15	0.3M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
V4_0001_RNA_0001_23H5VFLT4_s13	213.7M	0.0M	0.0M	15.1M	1.1M	191.4M	95.7M	95.6M	95.7M	95.7M	95.4M	95.9M	190.8M	0.0M
tih_rna_sample_00087_23H5VFLT4_s17	214.4M	0.0M	0.0M	15.3M	1.1M	191.4M	95.8M	95.7M	95.7M	95.7M	106.2M	85.2M	190.8M	0.0M
tih_rna_sample_00088_23H5VFLT4_s02	215.3M	0.0M	0.0M	16.9M	1.6M	190.5M	95.3M	95.2M	95.3M	95.2M	101.2M	89.4M	189.9M	0.0M
tih_rna_sample_00089_23H5VFLT4_s39	214.9M	0.0M	0.0M	16.2M	1.3M	191.2M	95.6M	95.5M	95.6M	95.6M	99.4M	91.8M	190.5M	0.0M
tih_rna_sample_00090_23H5VFLT4_s32	223.7M	0.0M	0.0M	25.2M	3.7M	185.6M	92.9M	92.7M	92.8M	92.8M	109.4M	76.2M	184.8M	0.0M
tih_rna_sample_00096_23H5VFLT4_s11	213.2M	0.0M	0.0M	14.4M	1.1M	192.0M	96.1M	96.0M	96.0M	96.0M	108.2M	83.8M	191.4M	0.0M
tih_rna_sample_00097_23H5VFLT4_s12	216.5M	0.0M	0.0M	17.4M	1.2M	190.8M	95.5M	95.4M	95.4M	95.4M	100.3M	90.5M	190.2M	0.0M
tih_rna_sample_00104_23H5VFLT4_s20	225.9M	0.0M	0.0M	28.2M	3.7M	184.4M	92.3M	92.1M	92.2M	92.2M	123.1M	61.4M	183.7M	0.0M
tih_rna_sample_00105_23H5VFLT4_s21	129.5M	0.0M	0.0M	18.5M	2.3M	102.4M	51.3M	51.1M	51.2M	51.2M	77.9M	24.5M	101.9M	0.0M
tih_rna_sample_00111_23H5VFLT4_s30	220.4M	0.0M	0.0M	22.1M	2.9M	187.6M	93.9M	93.7M	93.8M	93.8M	126.5M	61.1M	186.8M	0.0M
tih_rna_sample_00115_23H5VFLT4_s35	219.7M	0.0M	0.0M	21.1M	2.3M	188.9M	94.5M	94.3M	94.5M	94.4M	120.5M	68.4M	188.1M	0.0M
tih_rna_sample_00116_23H5VFLT4_s36	216.1M	0.0M	0.0M	17.4M	1.6M	190.1M	95.1M	95.0M	95.1M	95.0M	109.3M	80.8M	189.3M	0.0M
tih_rna_sample_00117_23H5VFLT4_s37	216.8M	0.0M	0.0M	18.9M	1.7M	189.2M	94.7M	94.5M	94.6M	94.6M	112.1M	77.1M	188.6M	0.0M
tih_rna_sample_00118_23H5VFLT4_s38	215.3M	0.0M	0.0M	16.7M	1.2M	191.0M	95.6M	95.5M	95.5M	95.5M	101.0M	90.0M	190.4M	0.0M
tih_rna_sample_00121_23H5VFLT4_s41	218.6M	0.0M	0.0M	20.0M	2.0M	189.2M	94.7M	94.5M	94.6M	94.6M	113.2M	76.0M	188.5M	0.0M
tih_rna_sample_00122_23H5VFLT4_s42	221.1M	0.0M	0.0M	22.5M	2.2M	188.6M	94.4M	94.2M	94.3M	94.3M	125.2M	63.3M	187.8M	0.0M
tih_rna_sample_00124_23H5VFLT4_s31	212.0M	0.0M	0.0M	13.1M	1.4M	191.6M	95.9M	95.7M	95.8M	95.8M	102.3M	89.3M	190.8M	0.0M
tih_rna_sample_00127_23H5VFLT4_s08	217.8M	0.0M	0.0M	18.9M	1.7M	190.2M	95.1M	95.1M	95.1M	95.1M	114.8M	75.4M	189.3M	0.0M
tih_rna_sample_00163_23H5VFLT4_s43	213.0M	0.0M	0.0M	14.3M	1.1M	191.8M	95.9M	95.8M	95.9M	95.9M	105.4M	86.3M	191.2M	0.0M
tih_rna_sample_00218_23H5VFLT4_s10	212.7M	0.0M	0.0M	13.6M	1.1M	192.5M	96.3M	96.2M	96.3M	96.3M	97.9M	94.7M	191.8M	0.0M
tih_rna_sample_00220_23H5VFLT4_s16	214.5M	0.0M	0.0M	15.6M	1.4M	191.4M	95.8M	95.7M	95.7M	95.7M	107.8M	83.6M	190.7M	0.0M
tih_rna_sample_00235_23H5VFLT4_s07	213.9M	0.0M	0.0M	14.8M	1.2M	191.8M	96.0M	95.9M	95.9M	95.9M	100.6M	91.2M	191.1M	0.0M
tih_rna_sample_00248_23H5VFLT4_s01	215.4M	0.0M	0.0M	16.5M	1.9M	190.5M	95.3M	95.2M	95.3M	95.3M	109.1M	81.5M	189.8M	0.0M
tih_rna_sample_00251_23H5VFLT4_s03	217.7M	0.0M	0.0M	19.2M	1.4M	189.9M	95.0M	94.9M	95.0M	95.0M	111.3M	78.7M	189.3M	0.0M
tih_rna_sample_00252_23H5VFLT4_s04	214.6M	0.0M	0.0M	16.1M	1.2M	191.0M	95.5M	95.4M	95.5M	95.5M	107.0M	84.0M	190.3M	0.0M
tih_rna_sample_00254_23H5VFLT4_s05	220.3M	0.0M	0.0M	22.0M	3.6M	186.4M	93.2M	93.2M	93.2M	93.2M	106.1M	80.3M	185.6M	0.0M
tih_rna_sample_00261_23H5VFLT4_s06	221.1M	0.0M	0.0M	22.9M	1.7M	188.8M	94.4M	94.3M	94.4M	94.4M	114.2M	74.6M	188.1M	0.0M
tih_rna_sample_00272_23H5VFLT4_s09	212.8M	0.0M	0.0M	14.1M	1.1M	192.2M	96.1M	96.0M	96.1M	96.1M	101.2M	91.0M	191.5M	0.0M
tih_rna_sample_00274_23H5VFLT4_s14	219.7M	0.0M	0.0M	21.0M	1.8M	189.2M	94.6M	94.6M	94.6M	94.6M	124.1M	65.1M	188.3M	0.0M
tih_rna_sample_00280_23H5VFLT4_s18	216.9M	0.0M	0.0M	18.1M	2.9M	189.1M	94.6M	94.5M	94.6M	94.5M	97.6M	91.5M	188.5M	0.0M
tih_rna_sample_00377_23H5VFLT4_s23	221.7M	0.0M	0.0M	22.5M	2.8M	187.7M	93.8M	93.9M	93.9M	93.8M	100.3M	87.4M	186.7M	0.0M
tih_rna_sample_00378_23H5VFLT4_s24	220.0M	0.0M	0.0M	20.8M	1.4M	190.1M	95.1M	95.0M	95.1M	95.0M	115.9M	74.2M	189.2M	0.0M
tih_rna_sample_00388_23H5VFLT4_s22	213.1M	0.0M	0.0M	14.2M	1.0M	192.5M	96.3M	96.2M	96.3M	96.3M	96.6M	96.0M	191.9M	0.0M
tih_rna_sample_00394_23H5VFLT4_s25	218.5M	0.0M	0.0M	20.1M	2.3M	188.7M	94.5M	94.3M	94.4M	94.4M	121.8M	66.9M	188.0M	0.0M
tih_rna_sample_00396_23H5VFLT4_s26	214.1M	0.0M	0.0M	15.3M	1.7M	191.0M	95.6M	95.5M	95.5M	95.5M	100.2M	90.8M	190.4M	0.0M
tih_rna_sample_00400_23H5VFLT4_s27	218.1M	0.0M	0.0M	19.5M	3.0M	187.8M	94.0M	93.8M	93.9M	93.9M	106.0M	81.8M	187.1M	0.0M
tih_rna_sample_00402_23H5VFLT4_s28	215.0M	0.0M	0.0M	15.9M	3.1M	189.4M	94.7M	94.6M	94.7M	94.7M	104.2M	85.2M	188.7M	0.0M
tih_rna_sample_00403_23H5VFLT4_s29	213.5M	0.0M	0.0M	14.6M	1.4M	191.8M	96.0M	95.8M	95.9M	95.9M	114.8M	77.0M	191.0M	0.0M
tih_rna_sample_00407_23H5VFLT4_s33	217.9M	0.0M	0.0M	19.8M	1.8M	188.7M	94.4M	94.3M	94.3M	94.3M	107.9M	80.7M	188.1M	0.0M
tih_rna_sample_00410_23H5VFLT4_s34	217.0M	0.0M	0.0M	18.9M	1.5M	189.5M	94.8M	94.7M	94.7M	94.7M	111.7M	77.8M	188.8M	0.0M
tih_rna_sample_00414_23H5VFLT4_s40	217.3M	0.0M	0.0M	18.7M	1.7M	189.3M	94.7M	94.6M	94.7M	94.7M	108.0M	81.3M	188.7M	0.0M
tih_rna_sample_00419_23H5VFLT4_s44	215.1M	0.0M	0.0M	16.5M	1.2M	190.8M	95.5M	95.4M	95.4M	95.4M	102.2M	88.6M	190.2M	0.0M
tih_rna_sample_00420_23H5VFLT4_s45	219.7M	0.0M	0.0M	22.5M	2.4M	186.7M	93.4M	93.3M	93.4M	93.4M	114.5M	72.2M	186.1M	0.0M
tih_rna_sample_00422_23H5VFLT4_s47	195.6M	0.0M	0.0M	25.4M	2.9M	158.6M	79.4M	79.2M	79.3M	79.3M	109.0M	49.6M	157.9M	0.0M
tih_rna_sample_00425_23H5VFLT4_s46	220.2M	0.0M	0.0M	22.8M	2.5M	186.8M	93.5M	93.3M	93.4M	93.4M	121.7M	65.1M	186.2M	0.0M
tih_rna_sample_00426_23H5VFLT4_s48	233.5M	0.0M	0.0M	36.2M	3.1M	182.7M	91.4M	91.3M	91.3M	91.4M	108.5M	74.2M	182.2M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	28693835	0.1554%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	4010	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	3520	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	1506	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	1387	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	188	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	171	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	174	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	147	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	142	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	180	0.0000%
GCTGCTGCCGGGGGGGC	2	79	0.0000%
GCCCCCCCGGCAGCAGC	2	83	0.0000%
GGCCCCCCCGGCAGCAGC	2	75	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATCCGAATCTGGGGG	1	846239	0.0046%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGATCTGGGGG	1	121907	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGCCATAATCTGGTGG	1	131705	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGCCATAATCTGGGGG	1	116490	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACGCAATCTGGGGG	1	331095	0.0018%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGCCTGTATCTAGTAT	1	139003	0.0008%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	48	9534052	0.1039%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	1990	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	1759	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	750	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	188	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	171	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	174	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	147	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	142	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	180	0.0000%
GCTGCTGCCGGGGGGGC	2	79	0.0000%
GCCCCCCCGGCAGCAGC	2	83	0.0000%
GGCCCCCCCGGCAGCAGC	2	75	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	1	691	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	253	0.0000%
GGGGGAGAGAGAGAGAGAGAGGGCGCGAAG	1	225	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	1	165	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	152	0.0000%
ACGGGAAGGCCCGGTGGGGAA	1	125	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCGTCACAGAGTAGCATCTAGTGTG	1	91	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER_SAME_GENE	awk	`filter same-gene (gene1==gene2)`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION_CRAM	samtools	`1.17`
SAMTOOLS_SORT_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_STARFUSION	samtools	`1.17`
SEQTK_SAMPLE	seqtk	`1.4.post122`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_FOR_ARRIBA	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
STAR_FOR_STARFUSION	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0003/B23H5VFLT4/nfcore_rnafusion_100M__5f1fa79--20260304-100305' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,debugging -name dev_rna_exp0003_5f1fa79 --input 's3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20251217_LH00166_0224_B23H5VFLT4__497a58ff--20251220-065827/samplesheets/rnaseq_samplesheetdev_rna_exp0003.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0003/B23H5VFLT4/nfcore_rnafusion_100M__5f1fa79--20260304-100305'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0003_5f1fa79
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,debugging
configFiles: N/A

Input/output options

input: s3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20251217_LH00166_0224_B23H5VFLT4__497a58ff--20251220-065827/samplesheets/rnaseq_samplesheetdev_rna_exp0003.csv
outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0003/B23H5VFLT4/nfcore_rnafusion_100M__5f1fa79--20260304-100305
strand: unknown
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks