MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-05, 01:20 UTC based on data in: /tmp/nxf.BrQMCCJoMY

General Statistics

Showing ²⁴⁰/₂₄₀ rows and ⁴⁹/₅₆ columns.

Sample Name	RNA contaminated	RNA contamination %	Total Reads	Expected Distinct	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Reads	Frac Unmapped	Unique Reads	Frac Dupes	Frac Reads On Target	Frac Reads Off Target	N Q30	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	GC Bias	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_02_RNA_0011_23KMKGLT4_1	Yes	65.02%	9999000000	425449541	160.3bp	146.0bp	0.07%	1.52%	0.48%	0.00%	0.15%	4.44%	0.76%	0.00%	197275536	0.01	149238847	0.24	1	0	0.97	284.46	116.00	1	1	0.000				186bp	438bp	24.5%	0.0%	95.8%	89.0%	95.8%	94.5M	15.3%	97.1%	25403.3Mb	197.3M	55.4%	98.6%	49.5%
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_1																											160.3bp	96.2%	94.9M																72.8%	54%	151bp	151bp	27%	100.0M
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_2																																													71.1%	55%	151bp	151bp	27%	100.0M
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_trimmed_1																																													72.7%	55%	133bp	151bp	18%	98.6M	72.7%	55%	133bp	151bp	18%	98.6M
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_trimmed_2																																													71.7%	55%	133bp	151bp	9%	98.6M	71.7%	55%	133bp	151bp	9%	98.6M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1	No	0.00%	9999000000	356475356	157.0bp	143.0bp	0.06%	1.48%	1.07%	0.00%	0.11%	3.98%	1.44%	0.00%	197158762	0.01	142223423	0.28	1	0	0.97	266.72	59.00	1	0	0.000				185bp	440bp	28.0%	0.0%	95.6%	89.0%	95.8%	94.4M	16.2%	97.0%	25233.9Mb	197.2M	55.0%	98.6%	51.7%
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_1																											157.0bp	95.4%	94.0M																72.0%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_2																																													71.5%	55%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_trimmed_1																																													72.0%	54%	132bp	147bp	18%	98.6M	72.0%	54%	132bp	147bp	18%	98.6M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_trimmed_2																																													72.2%	55%	132bp	147bp	9%	98.6M	72.2%	55%	132bp	147bp	9%	98.6M
NTC_0001_0001_23KMKGLT4_1	Yes	100.00%	9999000000	157504	52.3bp	31.0bp	0.02%	0.02%	0.01%	0.00%	0.01%	0.06%	0.00%	0.00%	995102	0.60	648398	0.35	0	0	0.93	0.00	0.00	0	0	0.000				32bp	30bp	87.4%	2.2%	4.9%	1.3%	3.5%	0.0M	48.8%	87.2%	63.6Mb	1.0M	67.3%	16.1%	53.3%
NTC_0001_0001_23KMKGLT4_1_1																											52.3bp	2.6%	0.0M																95.2%	72%	151bp	151bp	55%	3.1M
NTC_0001_0001_23KMKGLT4_1_2																																													91.6%	92%	151bp	151bp	55%	3.1M
NTC_0001_0001_23KMKGLT4_1_trimmed_1																																													74.8%	65%	43bp	32bp	45%	0.5M	74.8%	65%	43bp	32bp	45%	0.5M
NTC_0001_0001_23KMKGLT4_1_trimmed_2																																													72.8%	68%	103bp	151bp	55%	0.5M	72.8%	68%	103bp	151bp	55%	0.5M
tih_rna_sample_00129_23KMKGLT4_1	No	0.00%	9999000000	314888661	137.1bp	128.0bp	0.06%	0.84%	0.39%	0.00%	0.14%	2.69%	0.62%	0.00%	197441024	0.01	136152087	0.31	1	0	0.97	226.59	109.00	1	1	0.000				147bp	277bp	31.3%	0.0%	95.3%	87.3%	95.0%	93.8M	17.0%	97.1%	23914.3Mb	197.4M	56.3%	98.7%	64.9%
tih_rna_sample_00129_23KMKGLT4_1_1																											137.1bp	95.5%	94.3M																69.7%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00129_23KMKGLT4_1_2																																													68.2%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00129_23KMKGLT4_1_trimmed_1																																													69.7%	56%	125bp	132bp	18%	98.7M	69.7%	56%	125bp	132bp	18%	98.7M
tih_rna_sample_00129_23KMKGLT4_1_trimmed_2																																													68.7%	56%	125bp	132bp	9%	98.7M	68.7%	56%	125bp	132bp	9%	98.7M
tih_rna_sample_00134_23KMKGLT4_1	No	0.00%	9999000000	95796504	117.6bp	112.0bp	0.05%	0.91%	0.42%	0.00%	0.11%	2.53%	0.62%	0.00%	193981654	0.03	57999581	0.70	1	0	0.96	54.81	18.00	0	0	0.000				114bp	145bp	72.4%	0.0%	89.3%	72.9%	89.2%	86.5M	35.8%	96.0%	21154.5Mb	194.0M	61.7%	97.0%	79.3%
tih_rna_sample_00134_23KMKGLT4_1_1																											117.6bp	86.7%	84.1M																79.7%	59%	151bp	151bp	27%	100.0M
tih_rna_sample_00134_23KMKGLT4_1_2																																													77.9%	60%	151bp	151bp	36%	100.0M
tih_rna_sample_00134_23KMKGLT4_1_trimmed_1																																													79.6%	61%	113bp	112bp	18%	97.0M	79.6%	61%	113bp	112bp	18%	97.0M
tih_rna_sample_00134_23KMKGLT4_1_trimmed_2																																													79.0%	61%	114bp	112bp	18%	97.0M	79.0%	61%	114bp	112bp	18%	97.0M
tih_rna_sample_00136_23KMKGLT4_1	No	0.00%	9999000000	433457573	140.2bp	131.0bp	0.07%	1.32%	0.32%	0.00%	0.15%	4.17%	0.51%	0.00%	197638852	0.01	149785291	0.24	1	0	0.97	248.52	126.00	1	1	0.000				141bp	235bp	24.4%	0.0%	93.6%	88.6%	95.4%	94.3M	13.2%	97.3%	24247.0Mb	197.6M	54.4%	98.8%	62.5%
tih_rna_sample_00136_23KMKGLT4_1_1																											140.2bp	94.2%	93.1M																66.7%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00136_23KMKGLT4_1_2																																													65.2%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00136_23KMKGLT4_1_trimmed_1																																													66.7%	54%	126bp	132bp	18%	98.8M	66.7%	54%	126bp	132bp	18%	98.8M
tih_rna_sample_00136_23KMKGLT4_1_trimmed_2																																													65.7%	54%	126bp	132bp	9%	98.8M	65.7%	54%	126bp	132bp	9%	98.8M
tih_rna_sample_00141_23KMKGLT4_1	No	0.00%	9999000000	347812568	141.6bp	129.0bp	0.07%	0.67%	0.47%	0.00%	0.14%	2.00%	0.67%	0.00%	197450010	0.01	140254058	0.29	1	0	0.97	239.90	111.00	1	1	0.000				147bp	284bp	29.2%	0.0%	95.2%	89.1%	95.7%	94.5M	16.1%	97.3%	24191.4Mb	197.5M	55.0%	98.7%	61.7%
tih_rna_sample_00141_23KMKGLT4_1_1																											141.6bp	95.6%	94.4M																72.2%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00141_23KMKGLT4_1_2																																													69.1%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00141_23KMKGLT4_1_trimmed_1																																													72.1%	54%	126bp	132bp	18%	98.7M	72.1%	54%	126bp	132bp	18%	98.7M
tih_rna_sample_00141_23KMKGLT4_1_trimmed_2																																													69.7%	55%	126bp	132bp	9%	98.7M	69.7%	55%	126bp	132bp	9%	98.7M
tih_rna_sample_00145_23KMKGLT4_1	No	0.00%	9999000000	279888937	124.0bp	117.0bp	0.12%	0.81%	0.42%	0.00%	0.25%	2.46%	0.66%	0.00%	197502698	0.01	133199206	0.33	1	0	0.97	200.41	99.00	1	0	0.000				128bp	219bp	32.9%	0.0%	94.6%	87.5%	94.9%	93.7M	17.0%	97.2%	22788.2Mb	197.5M	55.2%	98.8%	74.1%
tih_rna_sample_00145_23KMKGLT4_1_1																											124.0bp	95.1%	93.9M																70.1%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00145_23KMKGLT4_1_2																																													68.6%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00145_23KMKGLT4_1_trimmed_1																																													70.1%	55%	119bp	122bp	18%	98.8M	70.1%	55%	119bp	122bp	18%	98.8M
tih_rna_sample_00145_23KMKGLT4_1_trimmed_2																																													69.1%	55%	119bp	122bp	9%	98.8M	69.1%	55%	119bp	122bp	9%	98.8M
tih_rna_sample_00146_23KMKGLT4_1	No	0.00%	9999000000	471985212	151.6bp	140.0bp	0.05%	0.48%	0.36%	0.00%	0.11%	1.57%	0.56%	0.00%	197592062	0.01	147090186	0.26	1	0	0.97	268.69	130.00	1	1	0.000				174bp	371bp	25.7%	0.0%	95.1%	90.2%	96.0%	94.9M	15.2%	97.2%	25095.6Mb	197.6M	55.8%	98.8%	54.1%
tih_rna_sample_00146_23KMKGLT4_1_1																											151.6bp	95.5%	94.4M																70.7%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00146_23KMKGLT4_1_2																																													69.1%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00146_23KMKGLT4_1_trimmed_1																																													70.6%	55%	131bp	142bp	18%	98.8M	70.6%	55%	131bp	142bp	18%	98.8M
tih_rna_sample_00146_23KMKGLT4_1_trimmed_2																																													69.7%	55%	131bp	147bp	9%	98.8M	69.7%	55%	131bp	147bp	9%	98.8M
tih_rna_sample_00149_23KMKGLT4_1	No	0.00%	9999000000	304793854	127.2bp	119.0bp	0.15%	0.86%	0.33%	0.00%	0.31%	2.60%	0.51%	0.00%	197505948	0.01	138361987	0.30	1	0	0.97	209.29	95.00	1	0	0.000				125bp	195bp	30.1%	0.0%	93.2%	88.6%	95.5%	94.3M	16.7%	97.2%	22993.0Mb	197.5M	53.5%	98.8%	71.7%
tih_rna_sample_00149_23KMKGLT4_1_1																											127.2bp	93.6%	92.5M																68.8%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00149_23KMKGLT4_1_2																																													67.1%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00149_23KMKGLT4_1_trimmed_1																																													68.8%	53%	120bp	122bp	18%	98.8M	68.8%	53%	120bp	122bp	18%	98.8M
tih_rna_sample_00149_23KMKGLT4_1_trimmed_2																																													67.7%	53%	120bp	122bp	9%	98.8M	67.7%	53%	120bp	122bp	9%	98.8M
tih_rna_sample_00150_23KMKGLT4_1	No	0.00%	9990000000	460072778	137.2bp	126.0bp	0.24%	1.12%	0.48%	0.00%	0.50%	3.08%	0.65%	0.00%	197817500	0.01	144120462	0.27	1	0	0.97	241.45	94.00	1	0	0.000				140bp	299bp	27.3%	0.0%	95.1%	90.4%	96.1%	95.0M	14.7%	97.3%	23916.6Mb	197.8M	52.8%	98.9%	64.7%
tih_rna_sample_00150_23KMKGLT4_1_1																											137.2bp	95.2%	94.2M																72.2%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00150_23KMKGLT4_1_2																																													70.1%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00150_23KMKGLT4_1_trimmed_1																																													72.2%	52%	124bp	132bp	18%	98.9M	72.2%	52%	124bp	132bp	18%	98.9M
tih_rna_sample_00150_23KMKGLT4_1_trimmed_2																																													70.6%	52%	124bp	132bp	9%	98.9M	70.6%	52%	124bp	132bp	9%	98.9M
tih_rna_sample_00151_23KMKGLT4_1	No	0.00%	9999000000	431201967	150.5bp	138.0bp	0.12%	0.62%	0.42%	0.00%	0.26%	1.92%	0.60%	0.00%	197553822	0.01	148477864	0.25	1	0	0.97	267.04	124.00	1	1	0.000				163bp	350bp	25.0%	0.0%	94.8%	90.6%	96.3%	95.2M	15.2%	97.2%	24944.9Mb	197.6M	54.1%	98.8%	55.3%
tih_rna_sample_00151_23KMKGLT4_1_1																											150.5bp	95.5%	94.3M																71.6%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00151_23KMKGLT4_1_2																																													70.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00151_23KMKGLT4_1_trimmed_1																																													71.6%	53%	130bp	142bp	18%	98.8M	71.6%	53%	130bp	142bp	18%	98.8M
tih_rna_sample_00151_23KMKGLT4_1_trimmed_2																																													70.5%	54%	130bp	142bp	9%	98.8M	70.5%	54%	130bp	142bp	9%	98.8M
tih_rna_sample_00153_23KMKGLT4_1	No	0.00%	9999000000	91768097	106.9bp	103.0bp	0.13%	0.57%	0.34%	0.00%	0.27%	1.79%	0.53%	0.00%	197063372	0.01	59569627	0.70	1	0	0.97	54.71	23.00	0	0	0.000				104bp	126bp	70.6%	0.0%	91.2%	84.7%	94.3%	92.9M	37.6%	97.2%	20334.9Mb	197.1M	55.7%	98.5%	88.3%
tih_rna_sample_00153_23KMKGLT4_1_1																											106.9bp	91.5%	90.2M																77.7%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00153_23KMKGLT4_1_2																																													75.6%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00153_23KMKGLT4_1_trimmed_1																																													77.7%	55%	106bp	107bp	18%	98.5M	77.7%	55%	106bp	107bp	18%	98.5M
tih_rna_sample_00153_23KMKGLT4_1_trimmed_2																																													76.2%	55%	106bp	107bp	9%	98.5M	76.2%	55%	106bp	107bp	9%	98.5M
tih_rna_sample_00154_23KMKGLT4_1	No	0.00%	9999000000	201367633	146.4bp	135.0bp	0.10%	0.52%	0.23%	0.00%	0.18%	1.42%	0.33%	0.00%	196935812	0.01	118777039	0.40	1	0	0.97	201.68	107.00	1	1	0.000				160bp	340bp	40.2%	0.0%	94.6%	82.8%	92.8%	91.4M	23.8%	97.1%	24505.6Mb	196.9M	55.2%	98.5%	58.8%
tih_rna_sample_00154_23KMKGLT4_1_1																											146.4bp	94.7%	93.2M																72.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00154_23KMKGLT4_1_2																																													70.7%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00154_23KMKGLT4_1_trimmed_1																																													72.0%	54%	128bp	137bp	18%	98.5M	72.0%	54%	128bp	137bp	18%	98.5M
tih_rna_sample_00154_23KMKGLT4_1_trimmed_2																																													71.4%	55%	128bp	137bp	9%	98.5M	71.4%	55%	128bp	137bp	9%	98.5M
tih_rna_sample_00156_23KMKGLT4_1	No	0.00%	9999000000	5107976	122.1bp	116.0bp	0.21%	0.19%	0.11%	0.00%	0.37%	0.51%	0.18%	0.00%	50988182	0.44	27361771	0.46	0	0	0.97	5.09	1.00	0	0	0.000				114bp	140bp	83.5%	0.0%	89.8%	34.1%	46.6%	11.9M	42.9%	96.4%	5444.3Mb	51.0M	59.1%	90.8%	76.5%
tih_rna_sample_00156_23KMKGLT4_1_1																											122.1bp	47.8%	12.2M																88.2%	59%	151bp	151bp	45%	28.1M
tih_rna_sample_00156_23KMKGLT4_1_2																																													85.5%	60%	151bp	151bp	55%	28.1M
tih_rna_sample_00156_23KMKGLT4_1_trimmed_1																																													87.4%	58%	110bp	112bp	27%	25.5M	87.4%	58%	110bp	112bp	27%	25.5M
tih_rna_sample_00156_23KMKGLT4_1_trimmed_2																																													85.9%	59%	111bp	112bp	18%	25.5M	85.9%	59%	111bp	112bp	18%	25.5M
tih_rna_sample_00157_23KMKGLT4_1	No	0.00%	9999000000	275877988	134.1bp	123.0bp	0.20%	1.04%	0.47%	0.00%	0.40%	3.05%	0.69%	0.00%	197418192	0.01	134355033	0.32	1	0	0.97	221.01	108.00	1	1	0.000				141bp	282bp	32.3%	0.0%	95.5%	88.8%	95.4%	94.1M	18.2%	97.3%	23637.2Mb	197.4M	54.6%	98.7%	66.1%
tih_rna_sample_00157_23KMKGLT4_1_1																											134.1bp	95.9%	94.6M																72.6%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00157_23KMKGLT4_1_2																																													70.1%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00157_23KMKGLT4_1_trimmed_1																																													72.6%	54%	123bp	127bp	18%	98.7M	72.6%	54%	123bp	127bp	18%	98.7M
tih_rna_sample_00157_23KMKGLT4_1_trimmed_2																																													70.7%	54%	123bp	127bp	9%	98.7M	70.7%	54%	123bp	127bp	9%	98.7M
tih_rna_sample_00158_23KMKGLT4_1	No	0.00%	9999000000	267499384	142.3bp	131.0bp	0.29%	1.24%	0.50%	0.00%	0.56%	3.52%	0.73%	0.00%	196992726	0.01	135856537	0.31	1	0	0.97	232.31	96.00	1	0	0.000				148bp	269bp	31.4%	0.0%	95.6%	85.7%	94.2%	92.8M	18.9%	97.0%	24262.2Mb	197.0M	57.9%	98.5%	60.7%
tih_rna_sample_00158_23KMKGLT4_1_1																											142.3bp	95.8%	94.4M																72.2%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00158_23KMKGLT4_1_2																																													71.1%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00158_23KMKGLT4_1_trimmed_1																																													72.2%	57%	127bp	137bp	18%	98.5M	72.2%	57%	127bp	137bp	18%	98.5M
tih_rna_sample_00158_23KMKGLT4_1_trimmed_2																																													71.8%	58%	127bp	137bp	9%	98.5M	71.8%	58%	127bp	137bp	9%	98.5M
tih_rna_sample_00161_23KMKGLT4_1	No	0.00%	9999000000	240131285	124.4bp	116.0bp	0.10%	0.81%	0.43%	0.00%	0.21%	2.53%	0.67%	0.00%	197702488	0.01	126892760	0.36	1	0	0.97	189.20	83.00	1	0	0.000				124bp	203bp	36.1%	0.0%	94.6%	88.2%	95.5%	94.5M	19.0%	97.3%	22516.7Mb	197.7M	55.6%	98.9%	74.5%
tih_rna_sample_00161_23KMKGLT4_1_1																											124.4bp	95.1%	94.0M																70.7%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00161_23KMKGLT4_1_2																																													68.8%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00161_23KMKGLT4_1_trimmed_1																																													70.7%	55%	117bp	117bp	18%	98.9M	70.7%	55%	117bp	117bp	18%	98.9M
tih_rna_sample_00161_23KMKGLT4_1_trimmed_2																																													69.3%	55%	117bp	117bp	18%	98.9M	69.3%	55%	117bp	117bp	18%	98.9M
tih_rna_sample_00164_23KMKGLT4_1	No	0.00%	9990000000	72811525	117.4bp	108.0bp	0.27%	0.81%	0.38%	0.00%	0.56%	2.33%	0.53%	0.00%	196228510	0.12	89009958	0.55	1	0	0.97	86.58	34.00	1	0	0.000				114bp	168bp	62.2%	0.1%	91.1%	65.3%	80.6%	79.1M	30.0%	96.8%	20854.2Mb	196.2M	57.8%	98.1%	78.9%
tih_rna_sample_00164_23KMKGLT4_1_1																											117.4bp	81.2%	79.7M																78.9%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00164_23KMKGLT4_1_2																																													76.9%	56%	151bp	151bp	36%	100.0M
tih_rna_sample_00164_23KMKGLT4_1_trimmed_1																																													78.9%	57%	110bp	112bp	18%	98.1M	78.9%	57%	110bp	112bp	18%	98.1M
tih_rna_sample_00164_23KMKGLT4_1_trimmed_2																																													77.6%	57%	110bp	112bp	18%	98.1M	77.6%	57%	110bp	112bp	18%	98.1M
tih_rna_sample_00166_23KMKGLT4_1	No	0.00%	9999000000	203086529	133.0bp	122.0bp	0.10%	0.84%	0.35%	0.00%	0.23%	2.65%	0.55%	0.00%	197644284	0.01	121866232	0.38	1	0	0.97	197.24	87.00	1	0	0.000				139bp	263bp	38.7%	0.0%	95.6%	87.7%	95.0%	93.9M	21.9%	97.4%	23684.1Mb	197.6M	55.1%	98.8%	66.7%
tih_rna_sample_00166_23KMKGLT4_1_1																											133.0bp	96.0%	94.9M																74.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00166_23KMKGLT4_1_2																																													71.3%	54%	151bp	151bp	36%	100.0M
tih_rna_sample_00166_23KMKGLT4_1_trimmed_1																																													74.3%	54%	123bp	127bp	18%	98.8M	74.3%	54%	123bp	127bp	18%	98.8M
tih_rna_sample_00166_23KMKGLT4_1_trimmed_2																																													71.8%	55%	123bp	127bp	9%	98.8M	71.8%	55%	123bp	127bp	9%	98.8M
tih_rna_sample_00168_23KMKGLT4_1	No	0.00%	9999000000	199361185	128.9bp	121.0bp	0.19%	1.09%	0.48%	0.00%	0.38%	3.18%	0.71%	0.00%	196752462	0.02	122458900	0.38	1	0	0.97	177.85	76.00	1	0	0.000				127bp	194bp	38.7%	0.0%	93.7%	84.9%	93.2%	91.6M	22.3%	97.2%	22988.8Mb	196.8M	55.5%	98.4%	71.4%
tih_rna_sample_00168_23KMKGLT4_1_1																											128.9bp	94.1%	92.6M																71.2%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00168_23KMKGLT4_1_2																																													69.8%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00168_23KMKGLT4_1_trimmed_1																																													71.1%	55%	120bp	122bp	18%	98.4M	71.1%	55%	120bp	122bp	18%	98.4M
tih_rna_sample_00168_23KMKGLT4_1_trimmed_2																																													70.5%	55%	120bp	122bp	9%	98.4M	70.5%	55%	120bp	122bp	9%	98.4M
tih_rna_sample_00300_23KMKGLT4_1	No	0.00%	9999000000	53265716	116.7bp	111.0bp	0.16%	0.33%	0.16%	0.00%	0.45%	1.14%	0.30%	0.00%	194827410	0.03	38958798	0.80	1	0	0.97	28.93	6.00	0	0	0.000				123bp	183bp	82.4%	0.0%	90.7%	74.8%	90.5%	88.1M	48.2%	96.3%	21206.2Mb	194.8M	65.3%	97.4%	79.8%
tih_rna_sample_00300_23KMKGLT4_1_1																											116.7bp	89.0%	86.7M																86.1%	62%	151bp	151bp	27%	100.0M
tih_rna_sample_00300_23KMKGLT4_1_2																																													83.7%	62%	151bp	151bp	27%	100.0M
tih_rna_sample_00300_23KMKGLT4_1_trimmed_1																																													86.1%	65%	113bp	112bp	18%	97.4M	86.1%	65%	113bp	112bp	18%	97.4M
tih_rna_sample_00300_23KMKGLT4_1_trimmed_2																																													84.8%	65%	113bp	112bp	18%	97.4M	84.8%	65%	113bp	112bp	18%	97.4M
tih_rna_sample_00334_23KMKGLT4_1	No	0.00%	9990000000	319425471	150.7bp	137.0bp	0.10%	1.41%	0.61%	0.00%	0.20%	4.05%	0.90%	0.00%	197330434	0.01	140674863	0.29	1	0	0.97	255.97	102.00	1	1	0.000				169bp	402bp	28.9%	0.0%	95.5%	89.5%	96.0%	94.7M	17.6%	97.1%	24840.5Mb	197.3M	54.4%	98.7%	55.3%
tih_rna_sample_00334_23KMKGLT4_1_1																											150.7bp	96.0%	94.7M																73.6%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00334_23KMKGLT4_1_2																																													71.8%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00334_23KMKGLT4_1_trimmed_1																																													73.5%	54%	130bp	142bp	18%	98.7M	73.5%	54%	130bp	142bp	18%	98.7M
tih_rna_sample_00334_23KMKGLT4_1_trimmed_2																																													72.4%	54%	130bp	142bp	9%	98.7M	72.4%	54%	130bp	142bp	9%	98.7M
tih_rna_sample_00338_23KMKGLT4_1	No	0.00%	9999000000	58396856	118.9bp	111.0bp	0.04%	0.48%	0.21%	0.00%	0.09%	1.58%	0.34%	0.00%	194967272	0.01	45372802	0.77	1	0	0.97	42.78	20.00	0	0	0.000				114bp	145bp	77.8%	0.0%	91.7%	82.9%	93.6%	91.3M	44.5%	97.1%	21492.3Mb	195.0M	57.3%	97.5%	79.0%
tih_rna_sample_00338_23KMKGLT4_1_1																											118.9bp	91.7%	89.4M																82.2%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00338_23KMKGLT4_1_2																																													80.1%	56%	151bp	151bp	45%	100.0M
tih_rna_sample_00338_23KMKGLT4_1_trimmed_1																																													82.0%	57%	113bp	112bp	18%	97.5M	82.0%	57%	113bp	112bp	18%	97.5M
tih_rna_sample_00338_23KMKGLT4_1_trimmed_2																																													80.8%	57%	114bp	112bp	9%	97.5M	80.8%	57%	114bp	112bp	9%	97.5M
tih_rna_sample_00339_23KMKGLT4_1	No	0.00%	9999000000	369901869	137.1bp	126.0bp	0.15%	0.60%	0.38%	0.00%	0.30%	1.75%	0.54%	0.00%	197499402	0.01	142646860	0.28	1	0	0.97	241.63	97.00	1	0	0.000				142bp	290bp	27.9%	0.0%	96.0%	89.8%	96.0%	94.8M	16.3%	97.2%	23783.9Mb	197.5M	55.1%	98.7%	64.7%
tih_rna_sample_00339_23KMKGLT4_1_1																											137.1bp	96.2%	95.0M																73.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00339_23KMKGLT4_1_2																																													71.3%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00339_23KMKGLT4_1_trimmed_1																																													73.0%	54%	124bp	132bp	18%	98.7M	73.0%	54%	124bp	132bp	18%	98.7M
tih_rna_sample_00339_23KMKGLT4_1_trimmed_2																																													71.9%	55%	124bp	132bp	9%	98.7M	71.9%	55%	124bp	132bp	9%	98.7M
tih_rna_sample_00361_23KMKGLT4_1	No	0.00%	9999000000	301587835	133.8bp	122.0bp	0.09%	0.75%	0.33%	0.00%	0.17%	2.21%	0.49%	0.00%	197438278	0.01	137338749	0.30	1	0	0.97	224.51	96.00	1	0	0.000				136bp	253bp	30.6%	0.0%	95.5%	89.2%	95.8%	94.5M	17.2%	97.2%	23474.1Mb	197.4M	55.4%	98.7%	67.0%
tih_rna_sample_00361_23KMKGLT4_1_1																											133.8bp	95.7%	94.5M																71.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00361_23KMKGLT4_1_2																																													69.0%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00361_23KMKGLT4_1_trimmed_1																																													71.0%	55%	122bp	127bp	18%	98.7M	71.0%	55%	122bp	127bp	18%	98.7M
tih_rna_sample_00361_23KMKGLT4_1_trimmed_2																																													69.6%	55%	122bp	127bp	9%	98.7M	69.6%	55%	122bp	127bp	9%	98.7M
tih_rna_sample_00427_23KMKGLT4_1	No	0.00%	9999000000	295200004	134.4bp	125.0bp	0.09%	0.59%	0.30%	0.00%	0.20%	1.96%	0.46%	0.00%	197411058	0.01	130460578	0.34	1	0	0.97	209.72	98.00	1	0	0.000				141bp	255bp	34.2%	0.0%	94.4%	87.6%	95.1%	93.9M	18.7%	97.2%	23742.1Mb	197.4M	55.7%	98.7%	66.3%
tih_rna_sample_00427_23KMKGLT4_1_1																											134.4bp	94.8%	93.6M																70.9%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00427_23KMKGLT4_1_2																																													69.8%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00427_23KMKGLT4_1_trimmed_1																																													70.9%	55%	124bp	127bp	18%	98.7M	70.9%	55%	124bp	127bp	18%	98.7M
tih_rna_sample_00427_23KMKGLT4_1_trimmed_2																																													70.4%	55%	124bp	127bp	9%	98.7M	70.4%	55%	124bp	127bp	9%	98.7M
tih_rna_sample_00430_23KMKGLT4_1	No	0.00%	9999000000	273502826	130.5bp	122.0bp	0.07%	0.76%	0.29%	0.00%	0.16%	2.35%	0.47%	0.00%	197378234	0.01	135299592	0.31	1	0	0.97	209.66	105.00	1	1	0.000				131bp	214bp	31.7%	0.0%	93.7%	88.2%	95.3%	94.1M	16.4%	97.2%	23401.6Mb	197.4M	53.9%	98.7%	69.5%
tih_rna_sample_00430_23KMKGLT4_1_1																											130.5bp	94.1%	92.9M																67.3%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00430_23KMKGLT4_1_2																																													65.7%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00430_23KMKGLT4_1_trimmed_1																																													67.2%	53%	122bp	127bp	18%	98.7M	67.2%	53%	122bp	127bp	18%	98.7M
tih_rna_sample_00430_23KMKGLT4_1_trimmed_2																																													66.2%	54%	122bp	127bp	9%	98.7M	66.2%	54%	122bp	127bp	9%	98.7M
tih_rna_sample_00434_23KMKGLT4_1	No	0.00%	9999000000	379936234	138.7bp	128.0bp	0.10%	1.01%	0.42%	0.00%	0.21%	3.04%	0.62%	0.00%	197392268	0.01	146918280	0.26	1	0	0.97	244.54	125.00	1	1	0.000				142bp	261bp	25.9%	0.0%	94.4%	88.2%	94.9%	93.7M	14.4%	97.3%	24070.1Mb	197.4M	54.6%	98.7%	63.3%
tih_rna_sample_00434_23KMKGLT4_1_1																											138.7bp	95.2%	93.9M																68.5%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00434_23KMKGLT4_1_2																																													67.3%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00434_23KMKGLT4_1_trimmed_1																																													68.5%	54%	125bp	132bp	18%	98.7M	68.5%	54%	125bp	132bp	18%	98.7M
tih_rna_sample_00434_23KMKGLT4_1_trimmed_2																																													67.9%	54%	125bp	132bp	9%	98.7M	67.9%	54%	125bp	132bp	9%	98.7M
tih_rna_sample_00437_23KMKGLT4_1	No	0.00%	9999000000	235870300	143.1bp	133.0bp	0.04%	0.92%	0.41%	0.00%	0.09%	2.82%	0.66%	0.00%	196913046	0.01	130003969	0.34	1	0	0.97	221.93	83.00	1	0	0.000				150bp	264bp	34.4%	0.0%	95.5%	86.1%	94.4%	93.0M	19.2%	96.9%	24224.6Mb	196.9M	59.2%	98.5%	60.7%
tih_rna_sample_00437_23KMKGLT4_1_1																											143.1bp	95.9%	94.4M																70.2%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00437_23KMKGLT4_1_2																																													70.1%	58%	151bp	151bp	27%	100.0M
tih_rna_sample_00437_23KMKGLT4_1_trimmed_1																																													70.2%	59%	127bp	137bp	18%	98.5M	70.2%	59%	127bp	137bp	18%	98.5M
tih_rna_sample_00437_23KMKGLT4_1_trimmed_2																																													70.8%	59%	127bp	137bp	9%	98.5M	70.8%	59%	127bp	137bp	9%	98.5M
tih_rna_sample_00440_23KMKGLT4_1	No	0.00%	9990000000	119031459	117.2bp	112.0bp	0.14%	0.30%	0.30%	0.00%	0.32%	0.99%	0.46%	0.00%	196659672	0.01	91426241	0.54	1	0	0.97	113.91	49.00	1	0	0.000				115bp	154bp	54.1%	0.0%	92.6%	84.7%	94.1%	92.5M	27.3%	97.2%	21761.3Mb	196.7M	55.9%	98.3%	80.7%
tih_rna_sample_00440_23KMKGLT4_1_1																											117.2bp	93.0%	91.5M																71.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00440_23KMKGLT4_1_2																																													70.1%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00440_23KMKGLT4_1_trimmed_1																																													71.4%	55%	114bp	112bp	18%	98.3M	71.4%	55%	114bp	112bp	18%	98.3M
tih_rna_sample_00440_23KMKGLT4_1_trimmed_2																																													70.8%	56%	114bp	112bp	9%	98.3M	70.8%	56%	114bp	112bp	9%	98.3M
tih_rna_sample_00441_23KMKGLT4_1	No	0.00%	9999000000	370270675	150.6bp	139.0bp	0.11%	0.98%	0.44%	0.00%	0.23%	3.12%	0.70%	0.00%	197361178	0.01	142863484	0.28	1	0	0.97	257.72	109.00	1	1	0.000				166bp	328bp	27.8%	0.0%	94.8%	88.6%	95.6%	94.4M	15.6%	97.1%	24952.1Mb	197.4M	56.7%	98.7%	54.9%
tih_rna_sample_00441_23KMKGLT4_1_1																											150.6bp	95.4%	94.1M																68.9%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00441_23KMKGLT4_1_2																																													68.7%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00441_23KMKGLT4_1_trimmed_1																																													68.9%	56%	130bp	142bp	18%	98.7M	68.9%	56%	130bp	142bp	18%	98.7M
tih_rna_sample_00441_23KMKGLT4_1_trimmed_2																																													69.3%	56%	130bp	142bp	9%	98.7M	69.3%	56%	130bp	142bp	9%	98.7M
tih_rna_sample_00450_23KMKGLT4_1	No	0.00%	9990000000	201830228	119.7bp	113.0bp	0.07%	1.01%	0.42%	0.00%	0.15%	3.02%	0.62%	0.00%	197325972	0.01	118090367	0.40	1	0	0.97	162.31	71.00	1	0	0.000				116bp	157bp	40.6%	0.0%	93.6%	86.2%	94.7%	93.4M	20.1%	97.3%	22175.7Mb	197.3M	55.7%	98.7%	78.6%
tih_rna_sample_00450_23KMKGLT4_1_1																											119.7bp	93.8%	92.6M																68.3%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00450_23KMKGLT4_1_2																																													66.8%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00450_23KMKGLT4_1_trimmed_1																																													68.2%	55%	115bp	117bp	18%	98.7M	68.2%	55%	115bp	117bp	18%	98.7M
tih_rna_sample_00450_23KMKGLT4_1_trimmed_2																																													67.4%	55%	116bp	117bp	9%	98.7M	67.4%	55%	116bp	117bp	9%	98.7M
tih_rna_sample_00451_23KMKGLT4_1	No	0.00%	9999000000	349331107	126.8bp	119.0bp	0.08%	0.61%	0.38%	0.00%	0.17%	1.86%	0.53%	0.00%	197467778	0.01	144182220	0.27	1	0	0.97	219.10	121.00	1	1	0.000				126bp	199bp	27.3%	0.0%	93.7%	87.1%	94.8%	93.6M	14.9%	97.2%	23058.4Mb	197.5M	54.5%	98.7%	71.7%
tih_rna_sample_00451_23KMKGLT4_1_1																											126.8bp	94.3%	93.1M																67.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00451_23KMKGLT4_1_2																																													64.2%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00451_23KMKGLT4_1_trimmed_1																																													67.0%	54%	120bp	122bp	18%	98.7M	67.0%	54%	120bp	122bp	18%	98.7M
tih_rna_sample_00451_23KMKGLT4_1_trimmed_2																																													64.7%	54%	120bp	122bp	9%	98.7M	64.7%	54%	120bp	122bp	9%	98.7M
tih_rna_sample_00453_23KMKGLT4_1	No	0.00%	9999000000	223061137	134.8bp	125.0bp	0.05%	0.58%	0.31%	0.00%	0.09%	1.72%	0.48%	0.00%	197247580	0.00	126385948	0.36	1	0	0.97	195.89	92.00	1	0	0.000				136bp	224bp	36.1%	0.0%	92.7%	89.0%	95.8%	94.5M	21.2%	97.3%	23809.8Mb	197.2M	53.9%	98.6%	66.2%
tih_rna_sample_00453_23KMKGLT4_1_1																											134.8bp	93.8%	92.5M																70.9%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00453_23KMKGLT4_1_2																																													68.9%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00453_23KMKGLT4_1_trimmed_1																																													70.8%	53%	124bp	132bp	18%	98.6M	70.8%	53%	124bp	132bp	18%	98.6M
tih_rna_sample_00453_23KMKGLT4_1_trimmed_2																																													69.4%	54%	124bp	132bp	9%	98.6M	69.4%	54%	124bp	132bp	9%	98.6M
tih_rna_sample_00457_23KMKGLT4_1	No	0.00%	9999000000	341287335	142.2bp	132.0bp	0.07%	0.59%	0.33%	0.00%	0.15%	1.92%	0.52%	0.00%	197613256	0.01	137997487	0.30	1	0	0.97	241.87	104.00	1	1	0.000				157bp	334bp	30.4%	0.0%	96.1%	89.4%	95.7%	94.5M	17.0%	97.1%	24497.8Mb	197.6M	56.1%	98.8%	60.7%
tih_rna_sample_00457_23KMKGLT4_1_1																											142.2bp	96.4%	95.3M																71.5%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00457_23KMKGLT4_1_2																																													69.8%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00457_23KMKGLT4_1_trimmed_1																																													71.5%	55%	128bp	137bp	18%	98.8M	71.5%	55%	128bp	137bp	18%	98.8M
tih_rna_sample_00457_23KMKGLT4_1_trimmed_2																																													70.3%	56%	128bp	137bp	9%	98.8M	70.3%	56%	128bp	137bp	9%	98.8M
tih_rna_sample_00460_23KMKGLT4_1	No	0.00%	9990000000	90044135	129.2bp	120.0bp	0.07%	0.45%	0.19%	0.00%	0.14%	1.48%	0.32%	0.00%	195840344	0.01	59745977	0.69	1	0	0.97	77.03	34.00	1	0	0.000				125bp	176bp	70.1%	0.0%	94.0%	86.4%	95.0%	93.0M	41.8%	96.9%	22727.3Mb	195.8M	58.1%	97.9%	71.3%
tih_rna_sample_00460_23KMKGLT4_1_1																											129.2bp	94.2%	92.3M																78.5%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00460_23KMKGLT4_1_2																																													76.7%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00460_23KMKGLT4_1_trimmed_1																																													78.3%	57%	120bp	122bp	18%	97.9M	78.3%	57%	120bp	122bp	18%	97.9M
tih_rna_sample_00460_23KMKGLT4_1_trimmed_2																																													77.4%	58%	120bp	122bp	9%	97.9M	77.4%	58%	120bp	122bp	9%	97.9M
tih_rna_sample_00461_23KMKGLT4_1	No	0.00%	9999000000	505106198	140.0bp	130.0bp	0.20%	0.92%	0.45%	0.00%	0.40%	2.68%	0.64%	0.00%	197565768	0.01	151385204	0.23	1	0	0.97	259.52	104.00	1	1	0.000				146bp	288bp	23.5%	0.0%	95.1%	88.5%	95.5%	94.3M	14.6%	97.3%	24215.7Mb	197.6M	54.3%	98.8%	62.0%
tih_rna_sample_00461_23KMKGLT4_1_1																											140.0bp	95.7%	94.5M																70.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00461_23KMKGLT4_1_2																																													69.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00461_23KMKGLT4_1_trimmed_1																																													70.4%	54%	126bp	132bp	18%	98.8M	70.4%	54%	126bp	132bp	18%	98.8M
tih_rna_sample_00461_23KMKGLT4_1_trimmed_2																																													70.1%	54%	126bp	132bp	9%	98.8M	70.1%	54%	126bp	132bp	9%	98.8M
tih_rna_sample_00462_23KMKGLT4_1	No	0.00%	9999000000	473298133	142.9bp	132.0bp	0.05%	0.68%	0.60%	0.00%	0.11%	2.10%	0.82%	0.00%	197679234	0.01	143599925	0.27	1	0	0.97	256.30	103.00	1	1	0.000				162bp	375bp	27.5%	0.0%	96.3%	90.9%	96.3%	95.2M	15.6%	97.2%	24527.7Mb	197.7M	54.9%	98.8%	60.0%
tih_rna_sample_00462_23KMKGLT4_1_1																											142.9bp	96.6%	95.5M																72.0%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00462_23KMKGLT4_1_2																																													70.8%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00462_23KMKGLT4_1_trimmed_1																																													72.1%	54%	128bp	137bp	18%	98.8M	72.1%	54%	128bp	137bp	18%	98.8M
tih_rna_sample_00462_23KMKGLT4_1_trimmed_2																																													71.3%	55%	128bp	137bp	9%	98.8M	71.3%	55%	128bp	137bp	9%	98.8M
tih_rna_sample_00464_23KMKGLT4_1	No	0.00%	9999000000	386634916	130.8bp	123.0bp	0.12%	1.14%	0.51%	0.00%	0.23%	3.40%	0.74%	0.00%	197560478	0.01	144792167	0.27	1	0	0.97	230.33	112.00	1	1	0.000				132bp	231bp	26.9%	0.0%	94.5%	88.8%	95.5%	94.3M	15.1%	97.2%	23444.9Mb	197.6M	53.8%	98.8%	69.0%
tih_rna_sample_00464_23KMKGLT4_1_1																											130.8bp	95.0%	93.8M																68.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00464_23KMKGLT4_1_2																																													66.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00464_23KMKGLT4_1_trimmed_1																																													68.3%	53%	122bp	127bp	18%	98.8M	68.3%	53%	122bp	127bp	18%	98.8M
tih_rna_sample_00464_23KMKGLT4_1_trimmed_2																																													66.9%	53%	122bp	127bp	9%	98.8M	66.9%	53%	122bp	127bp	9%	98.8M
tih_rna_sample_00467_23KMKGLT4_1	No	0.00%	9999000000	270836036	114.9bp	109.0bp	0.11%	1.26%	0.46%	0.00%	0.23%	3.70%	0.71%	0.00%	197330278	0.02	130925862	0.34	1	0	0.97	178.54	74.00	1	0	0.000				113bp	153bp	34.2%	0.0%	94.3%	83.9%	93.5%	92.3M	15.4%	97.2%	21473.3Mb	197.3M	57.4%	98.7%	81.5%
tih_rna_sample_00467_23KMKGLT4_1_1																											114.9bp	94.5%	93.2M																69.2%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00467_23KMKGLT4_1_2																																													67.2%	56%	151bp	151bp	36%	100.0M
tih_rna_sample_00467_23KMKGLT4_1_trimmed_1																																													69.1%	57%	112bp	112bp	18%	98.7M	69.1%	57%	112bp	112bp	18%	98.7M
tih_rna_sample_00467_23KMKGLT4_1_trimmed_2																																													67.8%	57%	112bp	112bp	9%	98.7M	67.8%	57%	112bp	112bp	9%	98.7M
tih_rna_sample_00473_23KMKGLT4_1	No	0.00%	9999000000	380355958	140.4bp	130.0bp	0.08%	0.64%	0.49%	0.00%	0.17%	1.93%	0.70%	0.00%	197532068	0.01	137311509	0.30	1	0	0.97	241.29	96.00	1	0	0.000				154bp	336bp	30.7%	0.0%	96.7%	88.6%	95.5%	94.3M	15.9%	97.2%	24215.6Mb	197.5M	55.0%	98.8%	62.5%
tih_rna_sample_00473_23KMKGLT4_1_1																											140.4bp	96.6%	95.4M																72.3%	54%	151bp	151bp	36%	100.0M
tih_rna_sample_00473_23KMKGLT4_1_2																																													70.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00473_23KMKGLT4_1_trimmed_1																																													72.3%	54%	126bp	132bp	18%	98.8M	72.3%	54%	126bp	132bp	18%	98.8M
tih_rna_sample_00473_23KMKGLT4_1_trimmed_2																																													71.1%	55%	126bp	132bp	9%	98.8M	71.1%	55%	126bp	132bp	9%	98.8M
tih_rna_sample_00475_23KMKGLT4_1	No	0.00%	9999000000	124502457	147.0bp	137.0bp	0.13%	0.51%	0.28%	0.00%	0.28%	1.63%	0.46%	0.00%	196730434	0.03	102243307	0.48	1	0	0.97	163.39	61.00	1	0	0.000				157bp	301bp	49.6%	0.0%	94.6%	81.5%	91.3%	89.8M	32.6%	97.1%	24629.9Mb	196.7M	56.3%	98.4%	58.5%
tih_rna_sample_00475_23KMKGLT4_1_1																											147.0bp	95.3%	93.8M																75.6%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00475_23KMKGLT4_1_2																																													74.5%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00475_23KMKGLT4_1_trimmed_1																																													75.5%	56%	129bp	137bp	18%	98.4M	75.5%	56%	129bp	137bp	18%	98.4M
tih_rna_sample_00475_23KMKGLT4_1_trimmed_2																																													75.2%	56%	129bp	137bp	9%	98.4M	75.2%	56%	129bp	137bp	9%	98.4M
tih_rna_sample_00476_23KMKGLT4_1	No	0.00%	9999000000	249878667	130.4bp	121.0bp	0.13%	0.74%	0.31%	0.00%	0.29%	2.38%	0.51%	0.00%	197540160	0.01	127217717	0.36	1	0	0.97	198.98	92.00	1	0	0.000				135bp	233bp	35.8%	0.0%	94.5%	88.2%	95.5%	94.3M	18.6%	97.2%	23315.4Mb	197.5M	56.3%	98.8%	69.3%
tih_rna_sample_00476_23KMKGLT4_1_1																											130.4bp	95.0%	93.8M																69.9%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00476_23KMKGLT4_1_2																																													68.3%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00476_23KMKGLT4_1_trimmed_1																																													69.9%	56%	121bp	127bp	18%	98.8M	69.9%	56%	121bp	127bp	18%	98.8M
tih_rna_sample_00476_23KMKGLT4_1_trimmed_2																																													68.8%	56%	121bp	127bp	9%	98.8M	68.8%	56%	121bp	127bp	9%	98.8M
tih_rna_sample_00479_23KMKGLT4_1	No	0.00%	9999000000	421620051	136.2bp	127.0bp	0.09%	1.17%	0.47%	0.00%	0.20%	3.65%	0.71%	0.00%	197877914	0.01	139776122	0.29	1	0	0.97	236.70	101.00	1	1	0.000				151bp	331bp	29.5%	0.0%	95.5%	89.7%	95.9%	94.8M	15.5%	97.1%	24037.0Mb	197.9M	53.7%	98.9%	64.5%
tih_rna_sample_00479_23KMKGLT4_1_1																											136.2bp	95.9%	94.9M																72.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00479_23KMKGLT4_1_2																																													70.1%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00479_23KMKGLT4_1_trimmed_1																																													72.3%	53%	125bp	132bp	18%	98.9M	72.3%	53%	125bp	132bp	18%	98.9M
tih_rna_sample_00479_23KMKGLT4_1_trimmed_2																																													70.5%	53%	125bp	132bp	9%	98.9M	70.5%	53%	125bp	132bp	9%	98.9M
tih_rna_sample_00480_23KMKGLT4_1	No	0.00%	9999000000	430824220	131.5bp	122.0bp	0.17%	1.04%	0.46%	0.00%	0.35%	3.13%	0.65%	0.00%	197594346	0.01	147305374	0.25	1	0	0.97	234.71	114.00	1	1	0.000				129bp	215bp	25.6%	0.0%	94.6%	88.4%	95.6%	94.5M	14.7%	97.3%	23292.3Mb	197.6M	54.2%	98.8%	69.2%
tih_rna_sample_00480_23KMKGLT4_1_1																											131.5bp	94.9%	93.8M																69.6%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00480_23KMKGLT4_1_2																																													67.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00480_23KMKGLT4_1_trimmed_1																																													69.5%	54%	121bp	127bp	18%	98.8M	69.5%	54%	121bp	127bp	18%	98.8M
tih_rna_sample_00480_23KMKGLT4_1_trimmed_2																																													67.9%	54%	121bp	127bp	9%	98.8M	67.9%	54%	121bp	127bp	9%	98.8M
tih_rna_sample_00481_23KMKGLT4_1	No	0.00%	9999000000	367421299	144.7bp	133.0bp	0.15%	0.83%	0.42%	0.00%	0.32%	2.52%	0.64%	0.00%	197346348	0.02	145447671	0.26	1	0	0.97	252.54	119.00	1	1	0.000				156bp	332bp	26.8%	0.0%	95.5%	86.7%	94.1%	92.8M	17.2%	97.2%	24460.1Mb	197.3M	55.0%	98.7%	59.3%
tih_rna_sample_00481_23KMKGLT4_1_1																											144.7bp	95.8%	94.5M																72.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00481_23KMKGLT4_1_2																																													70.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00481_23KMKGLT4_1_trimmed_1																																													72.5%	54%	127bp	137bp	18%	98.7M	72.5%	54%	127bp	137bp	18%	98.7M
tih_rna_sample_00481_23KMKGLT4_1_trimmed_2																																													71.1%	55%	127bp	137bp	9%	98.7M	71.1%	55%	127bp	137bp	9%	98.7M
tih_rna_sample_00482_23KMKGLT4_1	Yes	19.41%	9999000000	48076243	118.2bp	112.0bp	0.13%	0.58%	0.28%	0.00%	0.28%	1.78%	0.44%	0.00%	191474862	0.02	42812324	0.78	1	0	0.97	42.69	18.00	0	0	0.000				115bp	155bp	78.9%	0.0%	93.4%	84.0%	93.7%	89.7M	44.6%	97.1%	21140.6Mb	191.5M	56.9%	97.4%	79.4%
tih_rna_sample_00482_23KMKGLT4_1_1																											118.2bp	93.2%	89.2M																82.7%	55%	151bp	151bp	27%	98.3M
tih_rna_sample_00482_23KMKGLT4_1_2																																													80.7%	56%	151bp	151bp	36%	98.3M
tih_rna_sample_00482_23KMKGLT4_1_trimmed_1																																													82.6%	56%	114bp	112bp	18%	95.7M	82.6%	56%	114bp	112bp	18%	95.7M
tih_rna_sample_00482_23KMKGLT4_1_trimmed_2																																													81.5%	57%	114bp	112bp	9%	95.7M	81.5%	57%	114bp	112bp	9%	95.7M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: SeqTools	Reads	SeqTools Reads	`reads`	None
\|\|	Custom content: SeqTools	Frac Unmapped	SeqTools Frac Unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools	Unique Reads	SeqTools Unique Reads	`unique_reads`	None
\|\|	Custom content: SeqTools	Frac Dupes	SeqTools Frac Dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools	Frac Reads On Target	SeqTools Frac Reads On Target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools	Frac Reads Off Target	SeqTools Frac Reads Off Target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools	N Q30	SeqTools N Q30	`n_q30`	None
\|\|	Custom content: SeqTools	Mean Depth	SeqTools Mean Depth	`mean_depth`	None
\|\|	Custom content: SeqTools	Q50 Depth	SeqTools Q50 Depth	`q50_depth`	None
\|\|	Custom content: SeqTools	Frac Bases Gt30X	SeqTools Frac Bases Gt30X	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools	Frac Bases Gt100X	SeqTools Frac Bases Gt100X	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools	GC Bias	Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_02_RNA_0011_23KMKGLT4_1	213.3M	0.0M	0.0M	15.4M	1.5M	190.4M	95.3M	95.2M	95.2M	95.2M	97.8M	92.6M	189.9M	0.0M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1	213.3M	0.0M	0.0M	15.4M	1.1M	190.5M	95.3M	95.2M	95.3M	95.3M	95.7M	94.8M	189.9M	0.0M
NTC_0001_0001_23KMKGLT4_1	3.6M	0.0M	0.0M	2.5M	0.6M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
tih_rna_sample_00129_23KMKGLT4_1	216.4M	0.0M	0.0M	18.1M	1.8M	189.5M	94.8M	94.7M	94.8M	94.8M	102.6M	87.0M	188.9M	0.0M
tih_rna_sample_00134_23KMKGLT4_1	239.2M	0.0M	0.0M	44.2M	6.3M	175.0M	87.5M	87.4M	87.5M	87.5M	116.6M	58.4M	174.3M	0.0M
tih_rna_sample_00136_23KMKGLT4_1	214.3M	0.0M	0.0M	15.9M	1.3M	190.5M	95.3M	95.2M	95.2M	95.2M	111.0M	79.5M	189.8M	0.0M
tih_rna_sample_00141_23KMKGLT4_1	213.4M	0.0M	0.0M	15.2M	1.3M	190.6M	95.3M	95.3M	95.3M	95.3M	105.1M	85.6M	190.1M	0.0M
tih_rna_sample_00145_23KMKGLT4_1	215.9M	0.0M	0.0M	17.4M	1.9M	189.5M	94.8M	94.7M	94.8M	94.7M	105.7M	83.8M	188.8M	0.0M
tih_rna_sample_00146_23KMKGLT4_1	211.7M	0.0M	0.0M	13.3M	1.3M	191.7M	95.9M	95.8M	95.8M	95.8M	100.2M	91.5M	191.0M	0.0M
tih_rna_sample_00149_23KMKGLT4_1	214.4M	0.0M	0.0M	16.1M	1.2M	190.6M	95.3M	95.2M	95.3M	95.3M	112.6M	77.9M	189.9M	0.0M
tih_rna_sample_00150_23KMKGLT4_1	211.5M	0.0M	0.0M	12.9M	1.2M	191.9M	96.0M	95.9M	95.9M	95.9M	101.9M	90.0M	191.3M	0.0M
tih_rna_sample_00151_23KMKGLT4_1	211.3M	0.0M	0.0M	13.1M	1.2M	191.9M	96.0M	95.9M	96.0M	95.9M	102.2M	89.7M	191.3M	0.0M
tih_rna_sample_00153_23KMKGLT4_1	220.8M	0.0M	0.0M	22.8M	2.3M	187.7M	93.9M	93.8M	93.9M	93.8M	129.7M	58.0M	187.0M	0.0M
tih_rna_sample_00154_23KMKGLT4_1	222.0M	0.0M	0.0M	24.4M	2.3M	184.4M	92.2M	92.2M	92.2M	92.2M	98.8M	85.6M	183.8M	0.0M
tih_rna_sample_00156_23KMKGLT4_1	70.4M	0.0M	0.0M	18.9M	22.7M	24.2M	12.1M	12.1M	12.1M	12.1M	16.7M	7.4M	24.0M	0.0M
tih_rna_sample_00157_23KMKGLT4_1	213.0M	0.0M	0.0M	14.9M	1.9M	189.7M	94.9M	94.8M	94.8M	94.8M	102.0M	87.7M	189.2M	0.0M
tih_rna_sample_00158_23KMKGLT4_1	218.1M	0.0M	0.0M	20.3M	2.5M	187.4M	93.8M	93.6M	93.7M	93.7M	105.0M	82.4M	186.8M	0.0M
tih_rna_sample_00161_23KMKGLT4_1	215.4M	0.0M	0.0M	17.0M	1.4M	190.5M	95.3M	95.2M	95.2M	95.2M	110.1M	80.3M	189.9M	0.0M
tih_rna_sample_00164_23KMKGLT4_1	243.9M	0.0M	0.0M	46.8M	23.9M	159.7M	79.9M	79.8M	79.8M	79.9M	96.6M	63.1M	159.2M	0.0M
tih_rna_sample_00166_23KMKGLT4_1	215.5M	0.0M	0.0M	17.0M	1.9M	189.6M	94.8M	94.8M	94.8M	94.8M	104.6M	85.1M	189.0M	0.0M
tih_rna_sample_00168_23KMKGLT4_1	217.3M	0.0M	0.0M	19.7M	4.6M	184.9M	92.5M	92.4M	92.5M	92.5M	109.8M	75.1M	184.4M	0.0M
tih_rna_sample_00300_23KMKGLT4_1	237.3M	0.0M	0.0M	41.4M	5.6M	178.3M	89.3M	89.0M	89.2M	89.1M	108.5M	69.8M	177.6M	0.0M
tih_rna_sample_00334_23KMKGLT4_1	212.6M	0.0M	0.0M	14.6M	1.2M	190.9M	95.5M	95.4M	95.4M	95.4M	98.0M	92.8M	190.4M	0.0M
tih_rna_sample_00338_23KMKGLT4_1	221.5M	0.0M	0.0M	25.7M	2.7M	184.3M	92.2M	92.1M	92.2M	92.1M	124.5M	59.7M	183.7M	0.0M
tih_rna_sample_00339_23KMKGLT4_1	212.3M	0.0M	0.0M	14.1M	1.1M	191.1M	95.6M	95.5M	95.6M	95.5M	102.4M	88.8M	190.6M	0.0M
tih_rna_sample_00361_23KMKGLT4_1	213.4M	0.0M	0.0M	15.1M	1.1M	191.0M	95.6M	95.5M	95.5M	95.5M	105.4M	85.6M	190.4M	0.0M
tih_rna_sample_00427_23KMKGLT4_1	215.8M	0.0M	0.0M	17.5M	1.8M	189.6M	94.9M	94.7M	94.8M	94.8M	105.0M	84.6M	189.0M	0.0M
tih_rna_sample_00430_23KMKGLT4_1	214.8M	0.0M	0.0M	16.6M	1.4M	190.1M	95.1M	95.0M	95.1M	95.1M	109.8M	80.3M	189.5M	0.0M
tih_rna_sample_00434_23KMKGLT4_1	214.0M	0.0M	0.0M	15.6M	2.2M	189.6M	94.8M	94.8M	94.8M	94.8M	105.6M	84.0M	188.8M	0.0M
tih_rna_sample_00437_23KMKGLT4_1	217.3M	0.0M	0.0M	19.6M	2.5M	187.7M	93.9M	93.8M	93.8M	93.8M	106.1M	81.6M	187.1M	0.0M
tih_rna_sample_00440_23KMKGLT4_1	220.3M	0.0M	0.0M	22.6M	2.1M	187.2M	93.7M	93.5M	93.6M	93.6M	118.5M	68.8M	186.5M	0.0M
tih_rna_sample_00441_23KMKGLT4_1	214.3M	0.0M	0.0M	16.2M	1.3M	190.6M	95.4M	95.2M	95.3M	95.3M	103.0M	87.6M	190.0M	0.0M
tih_rna_sample_00450_23KMKGLT4_1	218.4M	0.0M	0.0M	20.0M	1.9M	188.9M	94.5M	94.4M	94.4M	94.4M	119.8M	69.1M	188.2M	0.0M
tih_rna_sample_00451_23KMKGLT4_1	216.4M	0.0M	0.0M	17.9M	2.0M	189.3M	94.7M	94.6M	94.7M	94.6M	111.2M	78.0M	188.5M	0.0M
tih_rna_sample_00453_23KMKGLT4_1	213.5M	0.0M	0.0M	15.5M	0.9M	190.7M	95.4M	95.3M	95.4M	95.3M	110.0M	80.7M	190.1M	0.0M
tih_rna_sample_00457_23KMKGLT4_1	213.2M	0.0M	0.0M	14.6M	1.4M	191.2M	95.6M	95.6M	95.6M	95.6M	99.8M	91.4M	190.5M	0.0M
tih_rna_sample_00460_23KMKGLT4_1	216.8M	0.0M	0.0M	20.1M	1.6M	187.9M	94.0M	93.9M	93.9M	93.9M	118.7M	69.1M	187.2M	0.0M
tih_rna_sample_00461_23KMKGLT4_1	214.7M	0.0M	0.0M	16.3M	1.1M	190.7M	95.4M	95.3M	95.3M	95.3M	103.1M	87.6M	190.0M	0.0M
tih_rna_sample_00462_23KMKGLT4_1	210.8M	0.0M	0.0M	12.3M	1.1M	192.3M	96.2M	96.1M	96.2M	96.1M	97.9M	94.3M	191.6M	0.0M
tih_rna_sample_00464_23KMKGLT4_1	214.0M	0.0M	0.0M	15.6M	1.3M	190.7M	95.4M	95.3M	95.4M	95.3M	107.0M	83.7M	190.0M	0.0M
tih_rna_sample_00467_23KMKGLT4_1	221.5M	0.0M	0.0M	23.3M	3.0M	186.3M	93.2M	93.1M	93.2M	93.1M	118.3M	68.0M	185.7M	0.0M
tih_rna_sample_00473_23KMKGLT4_1	214.1M	0.0M	0.0M	15.8M	1.4M	190.2M	95.2M	95.1M	95.1M	95.1M	98.8M	91.4M	189.6M	0.0M
tih_rna_sample_00475_23KMKGLT4_1	221.6M	0.0M	0.0M	24.2M	6.3M	181.1M	90.6M	90.5M	90.5M	90.6M	100.2M	80.9M	180.6M	0.0M
tih_rna_sample_00476_23KMKGLT4_1	215.3M	0.0M	0.0M	16.9M	1.4M	190.5M	95.3M	95.2M	95.2M	95.2M	107.6M	82.8M	189.8M	0.0M
tih_rna_sample_00479_23KMKGLT4_1	213.0M	0.0M	0.0M	14.3M	1.1M	191.6M	95.8M	95.8M	95.8M	95.8M	98.1M	93.4M	190.9M	0.0M
tih_rna_sample_00480_23KMKGLT4_1	215.0M	0.0M	0.0M	16.7M	1.3M	190.6M	95.4M	95.2M	95.3M	95.3M	109.9M	80.7M	190.0M	0.0M
tih_rna_sample_00481_23KMKGLT4_1	215.2M	0.0M	0.0M	17.2M	3.7M	187.1M	93.6M	93.5M	93.6M	93.6M	99.3M	87.8M	186.6M	0.0M
tih_rna_sample_00482_23KMKGLT4_1	215.0M	0.0M	0.0M	22.5M	2.9M	181.4M	90.8M	90.7M	90.7M	90.7M	116.5M	65.0M	180.7M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	31375178	0.1708%
GTCCGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGA	5	393230	0.0021%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	42556	0.0002%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	42624	0.0002%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	16092	0.0001%
GGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGC	4	297161	0.0016%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	7669	0.0000%
CCCGTCTCCGCCCCCCGGCCCCGCGTCCTCCCTCGGGAGGGCGCGCGGGT	2	223956	0.0012%
GGGTGAGCCTGGCAGCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCC	2	267794	0.0015%
GCACCATCATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACC	2	661685	0.0036%
CTCCATTCTTTCCAGGGGGACCTGGGGGACCTCGGGGACCCATGGGACCT	2	326658	0.0018%
CATCATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACCTCTC	2	277893	0.0015%
GGGGCCAGCAAAGCCAGCAGGGCCGGGGGGACCAGGCTCACCACGGTCTC	2	219934	0.0012%
CCATCATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACCTCT	2	206585	0.0011%
GCGGTTATCAGTACGACCTGGCATGAAAACTATTCCTTCCTGTGGATTTT	2	258032	0.0014%
CCCACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAAGCACTTTA	2	209975	0.0011%
GCGGCATTTAACCATTACGCCAGCATCCTTGACAAAAGTCGCAATCCTCA	2	201796	0.0011%
GTCGTATACAAATGATTTATCCTTGCGCAAAATGACATTGCAATTCGCCG	2	191913	0.0010%
CTCGTCGAAAGCACTTTACAAATAACTGGGATCCTCGCCACACGGGATTC	2	128031	0.0007%
CACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAAGCACTT	2	122425	0.0007%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	48	9845280	0.1080%
GTCCGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGA	2	131295	0.0014%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	21052	0.0002%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	19867	0.0002%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	5779	0.0001%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	6666	0.0001%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	7774	0.0001%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	6717	0.0001%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	5897	0.0001%
CCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2583	0.0000%
CCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2223	0.0000%
GCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	1785	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAG	2	1409	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGG	2	2646	0.0000%
GAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	1421	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGG	2	2235	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTC	2	1436	0.0000%
CTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	1433	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGC	2	1809	0.0000%
CCCGTCTCCGCCCCCCGGCCCCGCGTCCTCCCTCGGGAGGGCGCGCGGGT	1	111688	0.0012%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER_SAME_GENE	awk	`filter same-gene (gene1==gene2)`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION_CRAM	samtools	`1.17`
SAMTOOLS_SORT_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_STARFUSION	samtools	`1.17`
SEQTK_SAMPLE	seqtk	`1.4.post122`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_FOR_ARRIBA	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
STAR_FOR_STARFUSION	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0004/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-101508' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,debugging -name dev_rna_exp0004_5f1fa79 --input 's3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260123_LH00166_0229_B23KMKGLT4__497a58ff--20260130-204339/samplesheets/rnaseq_samplesheetdev_rna_exp0004.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0004/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-101508'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0004_5f1fa79
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,debugging
configFiles: N/A

Input/output options

input: s3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260123_LH00166_0229_B23KMKGLT4__497a58ff--20260130-204339/samplesheets/rnaseq_samplesheetdev_rna_exp0004.csv
outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0004/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-101508
strand: unknown
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks