MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-10, 01:51 UTC based on data in: /tmp/nxf.yk5HkRHxZG

General Statistics

Showing ²³⁵/₂₃₅ rows and ⁴⁹/₅₆ columns.

Sample Name	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Unique Reads	Frac Dupes	Frac Reads On Target	Frac Reads Off Target	N Q30	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_02_RNA_0011_23LGNLLT4_1	Yes	63.48%	198225712	0.01	156586417	0.21	1	0	0.98	312.94	123.00	1	1	0.000	172.0bp	157.0bp	0.15%	1.70%	0.56%	0.00%	0.32%	4.98%	0.85%	0.00%	9999000000	566612648				230bp	581bp	21.2%	0.0%	93.8%	88.5%	95.6%	94.7M	14.5%	97.7%	26698.7Mb	198.2M	55.0%	99.1%	38.9%
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_1																											172.0bp	93.8%	93.0M																69.7%	54%	151bp	151bp	27%	100.0M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_2																																													69.3%	55%	151bp	151bp	18%	100.0M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_trimmed_1																																													69.8%	54%	138bp	151bp	18%	99.1M	69.8%	54%	138bp	151bp	18%	99.1M
FFPE_HD789_02_RNA_0011_23LGNLLT4_1_trimmed_2																																													69.8%	55%	138bp	151bp	9%	99.1M	69.8%	55%	138bp	151bp	9%	99.1M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1	No	0.00%	197999048	0.01	141917727	0.28	1	0	0.98	264.64	59.00	1	0	0.000	159.3bp	145.0bp	0.14%	1.59%	1.23%	0.00%	0.25%	4.31%	1.61%	0.00%	9990000000	346550529				206bp	515bp	28.5%	0.0%	92.9%	88.9%	95.7%	94.7M	19.2%	97.7%	26062.2Mb	198.0M	53.8%	99.0%	46.0%
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_1																											159.3bp	92.4%	91.5M																71.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_2																																													71.4%	53%	151bp	151bp	18%	100.0M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_trimmed_1																																													71.7%	53%	135bp	151bp	18%	99.0M	71.7%	53%	135bp	151bp	18%	99.0M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1_trimmed_2																																													72.0%	54%	135bp	151bp	9%	99.0M	72.0%	54%	135bp	151bp	9%	99.0M
NTC_0001_0001_23LGNLLT4_1	Yes	100.00%	458422	0.41	239218	0.48	0	0	0.94	0.00	0.00	0	0	0.000	42.5bp	31.0bp	0.00%	0.04%	0.02%	0.00%	0.00%	0.12%	0.01%	0.00%	9999000000	102047				23bp	24bp	80.7%	2.3%	6.2%	2.7%	10.2%	0.0M	65.5%	92.4%	28.8Mb	0.5M	66.7%	6.9%	52.5%
NTC_0001_0001_23LGNLLT4_1_1																											42.5bp	2.3%	0.0M																96.9%	74%	151bp	151bp	45%	3.3M
NTC_0001_0001_23LGNLLT4_1_2																																													95.4%	96%	151bp	151bp	55%	3.3M
NTC_0001_0001_23LGNLLT4_1_trimmed_1																																													61.1%	64%	67bp	37bp	36%	0.2M	61.1%	64%	67bp	37bp	36%	0.2M
NTC_0001_0001_23LGNLLT4_1_trimmed_2																																													61.4%	68%	69bp	37bp	36%	0.2M	61.4%	68%	69bp	37bp	36%	0.2M
tih_rna_sample_00298_23LGNLLT4_1	No	0.00%	198186658	0.01	153901410	0.22	1	0	0.98	268.34	127.00	1	1	0.000	147.5bp	138.0bp	0.46%	0.95%	0.53%	0.00%	1.02%	2.90%	0.74%	0.00%	9999000000	489156168				164bp	327bp	22.6%	0.0%	92.4%	86.5%	94.6%	93.7M	13.6%	97.7%	25469.3Mb	198.2M	54.7%	99.1%	53.4%
tih_rna_sample_00298_23LGNLLT4_1_1																											147.5bp	92.6%	91.8M																65.4%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00298_23LGNLLT4_1_2																																													64.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00298_23LGNLLT4_1_trimmed_1																																													65.3%	54%	131bp	147bp	18%	99.1M	65.3%	54%	131bp	147bp	18%	99.1M
tih_rna_sample_00298_23LGNLLT4_1_trimmed_2																																													64.7%	54%	132bp	147bp	9%	99.1M	64.7%	54%	132bp	147bp	9%	99.1M
tih_rna_sample_00303_23LGNLLT4_1	No	0.00%	198055590	0.01	133989365	0.32	1	0	0.98	205.07	101.00	1	1	0.000	135.1bp	128.0bp	0.14%	1.06%	0.45%	0.00%	0.29%	3.08%	0.64%	0.00%	9990000000	302839846				142bp	242bp	32.6%	0.0%	90.8%	87.2%	94.6%	93.7M	19.9%	97.7%	24446.7Mb	198.1M	54.1%	99.0%	64.0%
tih_rna_sample_00303_23LGNLLT4_1_1																											135.1bp	90.9%	90.0M																65.8%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00303_23LGNLLT4_1_2																																													64.5%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00303_23LGNLLT4_1_trimmed_1																																													65.7%	53%	126bp	132bp	18%	99.0M	65.7%	53%	126bp	132bp	18%	99.0M
tih_rna_sample_00303_23LGNLLT4_1_trimmed_2																																													65.0%	54%	126bp	132bp	9%	99.0M	65.0%	54%	126bp	132bp	9%	99.0M
tih_rna_sample_00307_23LGNLLT4_1	No	0.00%	198112512	0.01	122809269	0.38	1	0	0.98	191.84	93.00	1	0	0.000	137.1bp	128.0bp	0.16%	0.59%	0.36%	0.00%	0.36%	2.00%	0.58%	0.00%	9999000000	240637026				153bp	298bp	38.2%	0.0%	91.4%	89.9%	96.0%	95.1M	24.9%	97.7%	24607.3Mb	198.1M	54.0%	99.1%	62.3%
tih_rna_sample_00307_23LGNLLT4_1_1																											137.1bp	91.9%	91.0M																70.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00307_23LGNLLT4_1_2																																													68.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00307_23LGNLLT4_1_trimmed_1																																													70.1%	53%	127bp	137bp	18%	99.1M	70.1%	53%	127bp	137bp	18%	99.1M
tih_rna_sample_00307_23LGNLLT4_1_trimmed_2																																													68.8%	54%	127bp	137bp	9%	99.1M	68.8%	54%	127bp	137bp	9%	99.1M
tih_rna_sample_00308_23LGNLLT4_1	No	0.00%	197627086	0.01	120414589	0.39	1	0	0.98	153.45	69.00	1	0	0.000	118.5bp	113.0bp	0.38%	0.91%	0.39%	0.00%	0.78%	2.73%	0.58%	0.00%	9999000000	234078719				121bp	175bp	39.5%	0.0%	89.1%	86.4%	94.7%	93.6M	24.2%	97.7%	22582.8Mb	197.6M	53.1%	98.8%	76.5%
tih_rna_sample_00308_23LGNLLT4_1_1																											118.5bp	89.1%	88.0M																66.7%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00308_23LGNLLT4_1_2																																													65.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00308_23LGNLLT4_1_trimmed_1																																													66.7%	53%	117bp	117bp	18%	98.8M	66.7%	53%	117bp	117bp	18%	98.8M
tih_rna_sample_00308_23LGNLLT4_1_trimmed_2																																													65.8%	53%	117bp	117bp	9%	98.8M	65.8%	53%	117bp	117bp	9%	98.8M
tih_rna_sample_00309_23LGNLLT4_1	Yes	0.26%	198183972	0.01	149576215	0.25	1	0	0.98	257.36	136.00	1	1	0.000	148.0bp	137.0bp	0.19%	0.90%	0.38%	0.00%	0.42%	2.91%	0.59%	0.00%	9999000000	424765592				163bp	312bp	24.7%	0.0%	91.5%	86.8%	94.8%	93.9M	16.4%	97.8%	25526.1Mb	198.2M	54.3%	99.1%	52.9%
tih_rna_sample_00309_23LGNLLT4_1_1																											148.0bp	92.0%	91.1M																66.5%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00309_23LGNLLT4_1_2																																													65.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00309_23LGNLLT4_1_trimmed_1																																													66.5%	54%	132bp	147bp	18%	99.1M	66.5%	54%	132bp	147bp	18%	99.1M
tih_rna_sample_00309_23LGNLLT4_1_trimmed_2																																													65.8%	54%	132bp	147bp	9%	99.1M	65.8%	54%	132bp	147bp	9%	99.1M
tih_rna_sample_00312_23LGNLLT4_1	No	0.00%	197535962	0.01	121865565	0.38	1	0	0.98	149.70	52.00	1	0	0.000	111.1bp	107.0bp	0.18%	0.84%	0.51%	0.00%	0.34%	2.34%	0.66%	0.00%	9999000000	240216199				110bp	145bp	38.9%	0.0%	91.4%	82.0%	93.1%	91.9M	17.9%	97.6%	21269.5Mb	197.5M	56.6%	98.8%	84.1%
tih_rna_sample_00312_23LGNLLT4_1_1																											111.1bp	90.2%	89.1M																66.1%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00312_23LGNLLT4_1_2																																													64.8%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00312_23LGNLLT4_1_trimmed_1																																													66.0%	56%	110bp	112bp	18%	98.8M	66.0%	56%	110bp	112bp	18%	98.8M
tih_rna_sample_00312_23LGNLLT4_1_trimmed_2																																													65.3%	56%	110bp	112bp	9%	98.8M	65.3%	56%	110bp	112bp	9%	98.8M
tih_rna_sample_00317_23LGNLLT4_1	No	0.00%	196408860	0.01	68820208	0.65	1	0	0.98	93.41	43.00	1	0	0.000	151.7bp	143.0bp	0.70%	0.36%	0.36%	0.00%	1.30%	1.05%	0.52%	0.00%	9999000000	95061014				158bp	248bp	65.7%	0.0%	89.5%	85.0%	93.9%	92.2M	50.5%	97.6%	25646.7Mb	196.4M	56.1%	98.2%	50.3%
tih_rna_sample_00317_23LGNLLT4_1_1																											151.7bp	90.0%	88.4M																76.4%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00317_23LGNLLT4_1_2																																													75.1%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00317_23LGNLLT4_1_trimmed_1																																													76.3%	55%	134bp	151bp	18%	98.2M	76.3%	55%	134bp	151bp	18%	98.2M
tih_rna_sample_00317_23LGNLLT4_1_trimmed_2																																													75.7%	56%	134bp	151bp	9%	98.2M	75.7%	56%	134bp	151bp	9%	98.2M
tih_rna_sample_00319_23LGNLLT4_1	No	0.00%	198127518	0.02	149998032	0.24	1	0	0.98	263.04	114.00	1	1	0.000	145.3bp	135.0bp	0.30%	1.18%	0.62%	0.00%	0.64%	3.52%	0.88%	0.00%	9999000000	471165379				169bp	389bp	24.7%	0.0%	94.2%	87.7%	94.7%	93.8M	15.2%	97.7%	25107.4Mb	198.1M	54.2%	99.1%	55.8%
tih_rna_sample_00319_23LGNLLT4_1_1																											145.3bp	94.2%	93.3M																69.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00319_23LGNLLT4_1_2																																													67.8%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00319_23LGNLLT4_1_trimmed_1																																													69.4%	53%	130bp	142bp	18%	99.1M	69.4%	53%	130bp	142bp	18%	99.1M
tih_rna_sample_00319_23LGNLLT4_1_trimmed_2																																													68.3%	54%	130bp	142bp	9%	99.1M	68.3%	54%	130bp	142bp	9%	99.1M
tih_rna_sample_00321_23LGNLLT4_1	No	0.00%	197743774	0.01	136351058	0.31	1	0	0.98	202.33	63.00	1	0	0.000	126.0bp	120.0bp	0.09%	0.82%	0.39%	0.00%	0.18%	2.40%	0.56%	0.00%	9999000000	340453034				131bp	202bp	31.4%	0.0%	92.9%	83.4%	93.5%	92.5M	16.3%	97.6%	23370.7Mb	197.7M	58.5%	98.9%	71.6%
tih_rna_sample_00321_23LGNLLT4_1_1																											126.0bp	92.3%	91.3M																66.6%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00321_23LGNLLT4_1_2																																													66.2%	57%	151bp	151bp	18%	100.0M
tih_rna_sample_00321_23LGNLLT4_1_trimmed_1																																													66.5%	58%	121bp	122bp	18%	98.9M	66.5%	58%	121bp	122bp	18%	98.9M
tih_rna_sample_00321_23LGNLLT4_1_trimmed_2																																													66.8%	58%	121bp	127bp	9%	98.9M	66.8%	58%	121bp	127bp	9%	98.9M
tih_rna_sample_00322_23LGNLLT4_1	No	0.00%	197525998	0.07	120647933	0.39	1	0	0.98	168.31	42.00	1	0	0.000	130.4bp	122.0bp	0.05%	0.53%	0.51%	0.00%	0.11%	1.72%	0.79%	0.00%	9999000000	197709420				146bp	257bp	42.0%	0.0%	94.3%	79.2%	88.1%	87.0M	25.5%	97.5%	23611.2Mb	197.5M	60.8%	98.8%	67.6%
tih_rna_sample_00322_23LGNLLT4_1_1																											130.4bp	87.6%	86.5M																74.7%	59%	151bp	151bp	27%	100.0M
tih_rna_sample_00322_23LGNLLT4_1_2																																													73.6%	59%	151bp	151bp	18%	100.0M
tih_rna_sample_00322_23LGNLLT4_1_trimmed_1																																													74.7%	60%	123bp	127bp	18%	98.8M	74.7%	60%	123bp	127bp	18%	98.8M
tih_rna_sample_00322_23LGNLLT4_1_trimmed_2																																													74.2%	60%	123bp	127bp	9%	98.8M	74.2%	60%	123bp	127bp	9%	98.8M
tih_rna_sample_00323_23LGNLLT4_1	No	0.00%	196097236	0.01	79619209	0.59	1	0	0.98	71.56	32.00	1	0	0.000	111.8bp	107.0bp	0.14%	0.89%	0.39%	0.00%	0.32%	2.86%	0.60%	0.00%	9999000000	135708954				112bp	146bp	60.3%	0.0%	85.6%	84.2%	93.9%	92.1M	35.1%	97.6%	21342.7Mb	196.1M	54.0%	98.0%	82.1%
tih_rna_sample_00323_23LGNLLT4_1_1																											111.8bp	85.2%	83.6M																72.6%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00323_23LGNLLT4_1_2																																													70.3%	54%	151bp	151bp	36%	100.0M
tih_rna_sample_00323_23LGNLLT4_1_trimmed_1																																													72.4%	53%	111bp	112bp	18%	98.0M	72.4%	53%	111bp	112bp	18%	98.0M
tih_rna_sample_00323_23LGNLLT4_1_trimmed_2																																													70.8%	54%	112bp	112bp	9%	98.0M	70.8%	54%	112bp	112bp	9%	98.0M
tih_rna_sample_00331_23LGNLLT4_1	No	0.00%	196929714	0.01	78043797	0.60	1	0	0.98	68.97	29.00	0	0	0.000	116.7bp	111.0bp	0.15%	0.80%	0.27%	0.00%	0.34%	2.56%	0.42%	0.00%	9999000000	179352009				117bp	147bp	61.2%	0.0%	84.6%	84.6%	94.0%	92.6M	38.2%	97.7%	22270.6Mb	196.9M	54.4%	98.5%	78.6%
tih_rna_sample_00331_23LGNLLT4_1_1																											116.7bp	84.9%	83.6M																72.7%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00331_23LGNLLT4_1_2																																													70.7%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00331_23LGNLLT4_1_trimmed_1																																													72.5%	54%	116bp	117bp	18%	98.5M	72.5%	54%	116bp	117bp	18%	98.5M
tih_rna_sample_00331_23LGNLLT4_1_trimmed_2																																													71.1%	54%	116bp	117bp	9%	98.5M	71.1%	54%	116bp	117bp	9%	98.5M
tih_rna_sample_00332_23LGNLLT4_1	No	0.00%	194591896	0.02	25280937	0.87	1	0	0.97	19.94	2.00	0	0	0.000	116.7bp	111.0bp	0.06%	0.21%	0.16%	0.00%	0.14%	0.85%	0.36%	0.00%	9999000000	22732180				186bp	315bp	88.9%	0.0%	93.7%	82.3%	93.0%	90.5M	58.4%	97.2%	21867.9Mb	194.6M	64.7%	97.3%	76.9%
tih_rna_sample_00332_23LGNLLT4_1_1																											116.7bp	92.4%	89.9M																90.4%	61%	151bp	151bp	27%	100.0M
tih_rna_sample_00332_23LGNLLT4_1_2																																													88.8%	62%	151bp	151bp	55%	100.0M
tih_rna_sample_00332_23LGNLLT4_1_trimmed_1																																													90.4%	64%	115bp	117bp	18%	97.3M	90.4%	64%	115bp	117bp	18%	97.3M
tih_rna_sample_00332_23LGNLLT4_1_trimmed_2																																													89.7%	64%	116bp	117bp	18%	97.3M	89.7%	64%	116bp	117bp	18%	97.3M
tih_rna_sample_00341_23LGNLLT4_1	No	0.00%	197117462	0.01	119428557	0.39	1	0	0.98	169.99	71.00	1	0	0.000	135.8bp	129.0bp	0.13%	1.26%	0.36%	0.00%	0.27%	3.86%	0.57%	0.00%	9999000000	209334517				136bp	190bp	39.9%	0.0%	89.0%	83.5%	93.7%	92.3M	25.2%	97.6%	24205.9Mb	197.1M	56.6%	98.6%	63.8%
tih_rna_sample_00341_23LGNLLT4_1_1																											135.8bp	88.8%	87.5M																66.3%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00341_23LGNLLT4_1_2																																													65.5%	56%	151bp	151bp	18%	100.0M
tih_rna_sample_00341_23LGNLLT4_1_trimmed_1																																													66.1%	56%	126bp	132bp	18%	98.6M	66.1%	56%	126bp	132bp	18%	98.6M
tih_rna_sample_00341_23LGNLLT4_1_trimmed_2																																													66.0%	56%	126bp	132bp	9%	98.6M	66.0%	56%	126bp	132bp	9%	98.6M
tih_rna_sample_00344_23LGNLLT4_1	No	0.00%	197033156	0.01	108758356	0.45	1	0	0.98	149.40	65.00	1	0	0.000	139.3bp	131.0bp	0.06%	1.36%	0.52%	0.00%	0.12%	4.12%	0.78%	0.00%	9990000000	177608299				144bp	218bp	45.3%	0.0%	87.0%	86.0%	94.5%	93.0M	31.7%	97.7%	24635.6Mb	197.0M	53.9%	98.5%	60.5%
tih_rna_sample_00344_23LGNLLT4_1_1																											139.3bp	87.3%	86.0M																67.9%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00344_23LGNLLT4_1_2																																													66.9%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00344_23LGNLLT4_1_trimmed_1																																													67.7%	53%	128bp	137bp	18%	98.5M	67.7%	53%	128bp	137bp	18%	98.5M
tih_rna_sample_00344_23LGNLLT4_1_trimmed_2																																													67.3%	54%	128bp	137bp	9%	98.5M	67.3%	54%	128bp	137bp	9%	98.5M
tih_rna_sample_00345_23LGNLLT4_1	No	0.00%	197449686	0.01	80708835	0.59	1	0	0.98	111.82	38.00	1	0	0.000	122.8bp	116.0bp	0.15%	0.90%	0.67%	0.00%	0.35%	2.86%	1.01%	0.00%	9990000000	92761288				126bp	213bp	59.6%	0.0%	95.9%	86.1%	94.8%	93.6M	36.9%	97.8%	22951.0Mb	197.4M	54.8%	98.7%	74.1%
tih_rna_sample_00345_23LGNLLT4_1_1																											122.8bp	95.0%	93.8M																74.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00345_23LGNLLT4_1_2																																													72.6%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00345_23LGNLLT4_1_trimmed_1																																													74.3%	54%	119bp	122bp	18%	98.7M	74.3%	54%	119bp	122bp	18%	98.7M
tih_rna_sample_00345_23LGNLLT4_1_trimmed_2																																													73.1%	54%	119bp	122bp	9%	98.7M	73.1%	54%	119bp	122bp	9%	98.7M
tih_rna_sample_00347_23LGNLLT4_1	No	0.00%	198195738	0.01	146764337	0.26	1	0	0.98	255.21	128.00	1	1	0.000	150.7bp	139.0bp	0.11%	1.02%	0.49%	0.00%	0.23%	3.09%	0.72%	0.00%	9999000000	395213001				166bp	343bp	26.1%	0.0%	92.2%	88.1%	95.2%	94.4M	16.8%	97.7%	25458.2Mb	198.2M	54.7%	99.1%	52.8%
tih_rna_sample_00347_23LGNLLT4_1_1																											150.7bp	92.3%	91.5M																67.4%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00347_23LGNLLT4_1_2																																													65.1%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00347_23LGNLLT4_1_trimmed_1																																													67.4%	54%	131bp	147bp	18%	99.1M	67.4%	54%	131bp	147bp	18%	99.1M
tih_rna_sample_00347_23LGNLLT4_1_trimmed_2																																													65.5%	55%	132bp	147bp	9%	99.1M	65.5%	55%	132bp	147bp	9%	99.1M
tih_rna_sample_00348_23LGNLLT4_1	No	0.00%	197753706	0.01	142034766	0.28	1	0	0.98	238.38	93.00	1	0	0.000	141.4bp	133.0bp	0.21%	0.63%	0.41%	0.00%	0.44%	1.86%	0.60%	0.00%	9999000000	347687671				154bp	284bp	28.4%	0.0%	92.5%	88.5%	95.6%	94.6M	17.5%	97.7%	24989.4Mb	197.8M	56.1%	98.9%	57.8%
tih_rna_sample_00348_23LGNLLT4_1_1																											141.4bp	92.6%	91.6M																66.3%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00348_23LGNLLT4_1_2																																													66.2%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00348_23LGNLLT4_1_trimmed_1																																													66.3%	55%	129bp	142bp	18%	98.9M	66.3%	55%	129bp	142bp	18%	98.9M
tih_rna_sample_00348_23LGNLLT4_1_trimmed_2																																													66.7%	56%	129bp	142bp	9%	98.9M	66.7%	56%	129bp	142bp	9%	98.9M
tih_rna_sample_00354_23LGNLLT4_1	No	0.00%	194240874	0.10	72804711	0.63	0	0	0.97	48.67	18.00	0	0	0.000	112.0bp	108.0bp	0.10%	0.62%	0.29%	0.00%	0.25%	2.22%	0.52%	0.00%	9999000000	93234729				110bp	132bp	69.7%	0.0%	89.4%	68.2%	81.7%	79.4M	39.5%	97.2%	20817.4Mb	194.2M	56.8%	97.1%	83.8%
tih_rna_sample_00354_23LGNLLT4_1_1																											112.0bp	88.9%	86.4M																76.7%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00354_23LGNLLT4_1_2																																													75.7%	56%	151bp	151bp	45%	100.0M
tih_rna_sample_00354_23LGNLLT4_1_trimmed_1																																													76.4%	56%	110bp	112bp	18%	97.1M	76.4%	56%	110bp	112bp	18%	97.1M
tih_rna_sample_00354_23LGNLLT4_1_trimmed_2																																													76.0%	56%	110bp	112bp	9%	97.1M	76.0%	56%	110bp	112bp	9%	97.1M
tih_rna_sample_00355_23LGNLLT4_1	No	0.00%	197969638	0.01	146925445	0.26	1	0	0.98	232.88	115.00	1	1	0.000	133.8bp	127.0bp	0.27%	0.89%	0.56%	0.00%	0.58%	2.73%	0.80%	0.00%	9999000000	406994659				142bp	256bp	26.1%	0.0%	92.4%	87.1%	94.5%	93.6M	16.1%	97.7%	24349.5Mb	198.0M	54.3%	99.0%	64.2%
tih_rna_sample_00355_23LGNLLT4_1_1																											133.8bp	92.6%	91.7M																66.6%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00355_23LGNLLT4_1_2																																													65.5%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00355_23LGNLLT4_1_trimmed_1																																													66.6%	54%	126bp	132bp	18%	99.0M	66.6%	54%	126bp	132bp	18%	99.0M
tih_rna_sample_00355_23LGNLLT4_1_trimmed_2																																													66.0%	54%	126bp	132bp	9%	99.0M	66.0%	54%	126bp	132bp	9%	99.0M
tih_rna_sample_00358_23LGNLLT4_1	No	0.00%	197566172	0.01	115546982	0.42	1	0	0.98	146.00	63.00	1	0	0.000	119.1bp	113.0bp	0.15%	0.82%	0.49%	0.00%	0.34%	2.54%	0.74%	0.00%	9999000000	241551962				119bp	158bp	42.0%	0.0%	90.0%	85.1%	94.0%	92.8M	23.7%	97.8%	22543.7Mb	197.6M	54.3%	98.8%	77.2%
tih_rna_sample_00358_23LGNLLT4_1_1																											119.1bp	89.8%	88.8M																64.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00358_23LGNLLT4_1_2																																													61.9%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00358_23LGNLLT4_1_trimmed_1																																													64.1%	54%	117bp	117bp	18%	98.8M	64.1%	54%	117bp	117bp	18%	98.8M
tih_rna_sample_00358_23LGNLLT4_1_trimmed_2																																													62.4%	54%	117bp	117bp	9%	98.8M	62.4%	54%	117bp	117bp	9%	98.8M
tih_rna_sample_00360_23LGNLLT4_1	No	0.00%	195778422	0.01	61166635	0.69	1	0	0.98	88.75	39.00	1	0	0.000	161.1bp	148.0bp	0.11%	0.45%	0.38%	0.00%	0.23%	1.53%	0.60%	0.00%	9999000000	79050193				193bp	401bp	69.4%	0.0%	91.1%	87.7%	95.2%	93.2M	53.5%	97.6%	26034.5Mb	195.8M	55.3%	97.9%	44.5%
tih_rna_sample_00360_23LGNLLT4_1_1																											161.1bp	91.4%	89.5M																78.6%	55%	151bp	151bp	36%	100.0M
tih_rna_sample_00360_23LGNLLT4_1_2																																													77.1%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00360_23LGNLLT4_1_trimmed_1																																													78.4%	55%	136bp	151bp	27%	97.9M	78.4%	55%	136bp	151bp	27%	97.9M
tih_rna_sample_00360_23LGNLLT4_1_trimmed_2																																													77.7%	55%	136bp	151bp	9%	97.9M	77.7%	55%	136bp	151bp	9%	97.9M
tih_rna_sample_00452_23LGNLLT4_1	No	0.00%	198254548	0.01	151881722	0.23	1	0	0.98	234.15	97.00	1	0	0.000	133.0bp	125.0bp	0.34%	0.76%	0.53%	0.00%	0.70%	2.22%	0.73%	0.00%	9999000000	579422261				137bp	233bp	23.5%	0.0%	90.8%	88.3%	95.5%	94.6M	13.6%	97.8%	24128.7Mb	198.3M	52.4%	99.1%	65.3%
tih_rna_sample_00452_23LGNLLT4_1_1																											133.0bp	91.0%	90.2M																66.6%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00452_23LGNLLT4_1_2																																													65.3%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00452_23LGNLLT4_1_trimmed_1																																													66.6%	52%	124bp	132bp	18%	99.1M	66.6%	52%	124bp	132bp	18%	99.1M
tih_rna_sample_00452_23LGNLLT4_1_trimmed_2																																													65.7%	52%	124bp	132bp	9%	99.1M	65.7%	52%	124bp	132bp	9%	99.1M
tih_rna_sample_00477_23LGNLLT4_1	No	0.00%	198237810	0.01	146538070	0.26	1	0	0.98	257.30	109.00	1	1	0.000	149.3bp	138.0bp	0.23%	1.25%	0.54%	0.00%	0.49%	3.72%	0.80%	0.00%	9999000000	431021014				171bp	382bp	26.2%	0.0%	92.9%	90.0%	96.1%	95.3M	16.2%	97.8%	25534.3Mb	198.2M	53.8%	99.1%	53.3%
tih_rna_sample_00477_23LGNLLT4_1_1																											149.3bp	93.2%	92.4M																67.6%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00477_23LGNLLT4_1_2																																													66.5%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00477_23LGNLLT4_1_trimmed_1																																													67.6%	53%	132bp	147bp	18%	99.1M	67.6%	53%	132bp	147bp	18%	99.1M
tih_rna_sample_00477_23LGNLLT4_1_trimmed_2																																													67.0%	54%	132bp	147bp	9%	99.1M	67.0%	54%	132bp	147bp	9%	99.1M
tih_rna_sample_00483_23LGNLLT4_1	No	0.00%	197215652	0.01	109042504	0.45	1	0	0.98	173.14	83.00	1	0	0.000	149.3bp	139.0bp	0.10%	0.82%	0.38%	0.00%	0.20%	2.44%	0.57%	0.00%	9999000000	210319732				158bp	275bp	45.3%	0.0%	90.8%	84.3%	93.7%	92.4M	31.2%	97.5%	25381.8Mb	197.2M	55.6%	98.6%	53.5%
tih_rna_sample_00483_23LGNLLT4_1_1																											149.3bp	90.5%	89.2M																68.6%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00483_23LGNLLT4_1_2																																													67.4%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00483_23LGNLLT4_1_trimmed_1																																													68.5%	55%	132bp	147bp	18%	98.6M	68.5%	55%	132bp	147bp	18%	98.6M
tih_rna_sample_00483_23LGNLLT4_1_trimmed_2																																													68.0%	55%	132bp	147bp	9%	98.6M	68.0%	55%	132bp	147bp	9%	98.6M
tih_rna_sample_00485_23LGNLLT4_1	No	0.00%	198199784	0.03	147709192	0.25	1	0	0.98	245.77	114.00	1	1	0.000	145.6bp	135.0bp	0.18%	0.67%	0.40%	0.00%	0.40%	2.18%	0.60%	0.00%	9999000000	450526957				156bp	292bp	26.2%	0.0%	91.9%	84.6%	92.4%	91.6M	15.9%	97.8%	25181.2Mb	198.2M	54.3%	99.1%	56.4%
tih_rna_sample_00485_23LGNLLT4_1_1																											145.6bp	92.4%	91.5M																67.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00485_23LGNLLT4_1_2																																													66.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00485_23LGNLLT4_1_trimmed_1																																													67.3%	54%	130bp	142bp	27%	99.1M	67.3%	54%	130bp	142bp	27%	99.1M
tih_rna_sample_00485_23LGNLLT4_1_trimmed_2																																													66.8%	54%	130bp	142bp	9%	99.1M	66.8%	54%	130bp	142bp	9%	99.1M
tih_rna_sample_00487_23LGNLLT4_1	No	0.00%	194378502	0.02	49905851	0.74	1	0	0.98	47.66	19.00	0	0	0.000	133.2bp	127.0bp	0.74%	0.64%	0.34%	0.00%	1.50%	1.96%	0.53%	0.00%	9990000000	64748662				138bp	201bp	75.9%	0.0%	88.4%	80.9%	92.3%	89.7M	53.4%	97.4%	23755.9Mb	194.4M	56.9%	97.2%	64.4%
tih_rna_sample_00487_23LGNLLT4_1_1																											133.2bp	87.5%	85.0M																80.2%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00487_23LGNLLT4_1_2																																													78.8%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00487_23LGNLLT4_1_trimmed_1																																													80.0%	56%	125bp	132bp	18%	97.2M	80.0%	56%	125bp	132bp	18%	97.2M
tih_rna_sample_00487_23LGNLLT4_1_trimmed_2																																													79.3%	57%	126bp	132bp	9%	97.2M	79.3%	57%	126bp	132bp	9%	97.2M
tih_rna_sample_00494_23LGNLLT4_1	No	0.00%	196522610	0.01	68914675	0.65	1	0	0.98	76.07	34.00	1	0	0.000	126.5bp	121.0bp	0.12%	0.75%	0.44%	0.00%	0.24%	2.38%	0.67%	0.00%	9990000000	102601660				127bp	175bp	65.7%	0.0%	89.5%	84.0%	94.0%	92.4M	43.1%	97.6%	23164.6Mb	196.5M	56.2%	98.3%	72.0%
tih_rna_sample_00494_23LGNLLT4_1_1																											126.5bp	89.0%	87.4M																74.7%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00494_23LGNLLT4_1_2																																													73.3%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00494_23LGNLLT4_1_trimmed_1																																													74.6%	56%	121bp	122bp	18%	98.3M	74.6%	56%	121bp	122bp	18%	98.3M
tih_rna_sample_00494_23LGNLLT4_1_trimmed_2																																													73.8%	56%	121bp	127bp	9%	98.3M	73.8%	56%	121bp	127bp	9%	98.3M
tih_rna_sample_00499_23LGNLLT4_1	No	0.00%	198298418	0.01	163425442	0.18	1	0	0.98	310.59	154.00	1	1	0.000	170.4bp	157.0bp	0.16%	0.64%	0.34%	0.00%	0.35%	2.08%	0.50%	0.00%	9999000000	676593885				192bp	399bp	17.7%	0.0%	90.4%	90.1%	96.0%	95.2M	12.5%	97.8%	26729.9Mb	198.3M	53.6%	99.1%	39.5%
tih_rna_sample_00499_23LGNLLT4_1_1																											170.4bp	91.1%	90.3M																66.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00499_23LGNLLT4_1_2																																													65.0%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00499_23LGNLLT4_1_trimmed_1																																													66.0%	53%	138bp	151bp	18%	99.1M	66.0%	53%	138bp	151bp	18%	99.1M
tih_rna_sample_00499_23LGNLLT4_1_trimmed_2																																													65.4%	53%	138bp	151bp	9%	99.1M	65.4%	53%	138bp	151bp	9%	99.1M
tih_rna_sample_00500_23LGNLLT4_1	No	0.00%	198206858	0.01	150262330	0.24	1	0	0.98	259.92	123.00	1	1	0.000	147.8bp	137.0bp	0.11%	0.81%	0.39%	0.00%	0.23%	2.53%	0.59%	0.00%	9999000000	473967937				166bp	335bp	24.3%	0.0%	92.1%	89.1%	95.7%	94.8M	16.3%	97.8%	25470.7Mb	198.2M	54.1%	99.1%	53.8%
tih_rna_sample_00500_23LGNLLT4_1_1																											147.8bp	92.5%	91.6M																66.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00500_23LGNLLT4_1_2																																													65.0%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00500_23LGNLLT4_1_trimmed_1																																													66.0%	53%	131bp	147bp	18%	99.1M	66.0%	53%	131bp	147bp	18%	99.1M
tih_rna_sample_00500_23LGNLLT4_1_trimmed_2																																													65.4%	54%	131bp	147bp	9%	99.1M	65.4%	54%	131bp	147bp	9%	99.1M
tih_rna_sample_00501_23LGNLLT4_1	No	0.00%	197661878	0.01	147944781	0.25	1	0	0.98	266.54	111.00	1	1	0.000	153.8bp	142.0bp	0.20%	0.51%	0.23%	0.00%	0.41%	1.58%	0.37%	0.00%	9999000000	376480483				163bp	275bp	25.4%	0.0%	93.1%	84.8%	94.3%	93.2M	17.0%	97.6%	25643.8Mb	197.7M	57.8%	98.8%	50.0%
tih_rna_sample_00501_23LGNLLT4_1_1																											153.8bp	93.8%	92.7M																68.1%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00501_23LGNLLT4_1_2																																													67.5%	57%	151bp	151bp	18%	100.0M
tih_rna_sample_00501_23LGNLLT4_1_trimmed_1																																													68.0%	57%	133bp	151bp	18%	98.8M	68.0%	57%	133bp	151bp	18%	98.8M
tih_rna_sample_00501_23LGNLLT4_1_trimmed_2																																													68.1%	57%	133bp	151bp	9%	98.8M	68.1%	57%	133bp	151bp	9%	98.8M
tih_rna_sample_00505_23LGNLLT4_1	No	0.00%	195016392	0.01	83276208	0.57	1	0	0.98	72.86	34.00	1	0	0.000	107.6bp	104.0bp	0.33%	0.77%	0.44%	0.00%	0.67%	2.32%	0.65%	0.00%	9999000000	144865353				107bp	131bp	58.1%	0.0%	85.6%	83.6%	93.5%	91.2M	31.4%	97.6%	20559.2Mb	195.0M	53.1%	97.5%	85.2%
tih_rna_sample_00505_23LGNLLT4_1_1																											107.6bp	85.1%	82.9M																69.0%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00505_23LGNLLT4_1_2																																													67.7%	53%	151bp	151bp	45%	100.0M
tih_rna_sample_00505_23LGNLLT4_1_trimmed_1																																													68.5%	53%	108bp	107bp	18%	97.5M	68.5%	53%	108bp	107bp	18%	97.5M
tih_rna_sample_00505_23LGNLLT4_1_trimmed_2																																													67.8%	53%	108bp	107bp	9%	97.5M	67.8%	53%	108bp	107bp	9%	97.5M
tih_rna_sample_00508_23LGNLLT4_1	No	0.00%	197931108	0.01	115309613	0.42	1	0	0.98	183.62	85.00	1	0	0.000	141.2bp	131.0bp	0.20%	0.49%	0.36%	0.00%	0.46%	1.64%	0.57%	0.00%	9999000000	215413814				155bp	295bp	42.0%	0.0%	92.0%	88.5%	95.6%	94.6M	28.6%	97.6%	24872.7Mb	197.9M	55.7%	99.0%	58.8%
tih_rna_sample_00508_23LGNLLT4_1_1																											141.2bp	92.4%	91.5M																71.4%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00508_23LGNLLT4_1_2																																													68.8%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00508_23LGNLLT4_1_trimmed_1																																													71.4%	55%	129bp	137bp	18%	99.0M	71.4%	55%	129bp	137bp	18%	99.0M
tih_rna_sample_00508_23LGNLLT4_1_trimmed_2																																													69.3%	55%	129bp	137bp	9%	99.0M	69.3%	55%	129bp	137bp	9%	99.0M
tih_rna_sample_00509_23LGNLLT4_1	No	0.00%	198137212	0.01	155943324	0.21	1	0	0.98	284.57	135.00	1	1	0.000	160.0bp	147.0bp	0.10%	0.66%	0.33%	0.00%	0.22%	2.16%	0.50%	0.00%	9999000000	574904013				180bp	359bp	21.4%	0.0%	91.3%	89.1%	95.8%	94.9M	13.5%	97.7%	26102.7Mb	198.1M	54.4%	99.1%	45.8%
tih_rna_sample_00509_23LGNLLT4_1_1																											160.0bp	91.7%	90.8M																65.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00509_23LGNLLT4_1_2																																													64.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00509_23LGNLLT4_1_trimmed_1																																													65.0%	54%	135bp	151bp	18%	99.1M	65.0%	54%	135bp	151bp	18%	99.1M
tih_rna_sample_00509_23LGNLLT4_1_trimmed_2																																													64.7%	54%	135bp	151bp	9%	99.1M	64.7%	54%	135bp	151bp	9%	99.1M
tih_rna_sample_00510_23LGNLLT4_1	No	0.00%	196959766	0.01	68001929	0.65	1	0	0.98	63.08	23.00	0	0	0.000	126.9bp	120.0bp	0.30%	0.29%	0.24%	0.00%	0.69%	0.86%	0.33%	0.00%	9999000000	124976832				125bp	165bp	66.2%	0.0%	85.1%	83.5%	93.8%	92.3M	43.1%	97.4%	23338.3Mb	197.0M	53.8%	98.5%	71.3%
tih_rna_sample_00510_23LGNLLT4_1_1																											126.9bp	85.2%	83.9M																74.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00510_23LGNLLT4_1_2																																													72.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00510_23LGNLLT4_1_trimmed_1																																													73.8%	53%	122bp	127bp	18%	98.5M	73.8%	53%	122bp	127bp	18%	98.5M
tih_rna_sample_00510_23LGNLLT4_1_trimmed_2																																													72.8%	53%	122bp	127bp	18%	98.5M	72.8%	53%	122bp	127bp	18%	98.5M
tih_rna_sample_00512_23LGNLLT4_1	No	0.00%	198406558	0.01	126000819	0.36	1	0	0.98	205.89	87.00	1	0	0.000	136.3bp	129.0bp	0.09%	0.71%	0.50%	0.00%	0.19%	2.42%	0.79%	0.00%	9999000000	291209087				168bp	374bp	36.8%	0.0%	93.5%	90.2%	96.0%	95.3M	21.8%	97.7%	24692.3Mb	198.4M	55.0%	99.2%	61.6%
tih_rna_sample_00512_23LGNLLT4_1_1																											136.3bp	93.6%	92.9M																69.4%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00512_23LGNLLT4_1_2																																													67.9%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00512_23LGNLLT4_1_trimmed_1																																													69.4%	54%	127bp	137bp	18%	99.2M	69.4%	54%	127bp	137bp	18%	99.2M
tih_rna_sample_00512_23LGNLLT4_1_trimmed_2																																													68.3%	55%	127bp	137bp	9%	99.2M	68.3%	55%	127bp	137bp	9%	99.2M
tih_rna_sample_00528_23LGNLLT4_1	Yes	0.15%	197470110	0.01	95073691	0.52	1	0	0.98	111.80	54.00	1	0	0.000	125.6bp	118.0bp	0.15%	0.88%	0.35%	0.00%	0.30%	2.65%	0.54%	0.00%	9999000000	164030013				125bp	173bp	52.4%	0.0%	88.4%	84.6%	94.0%	92.8M	36.1%	97.7%	23082.4Mb	197.5M	56.2%	98.7%	73.0%
tih_rna_sample_00528_23LGNLLT4_1_1																											125.6bp	88.5%	87.4M																70.1%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00528_23LGNLLT4_1_2																																													68.3%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00528_23LGNLLT4_1_trimmed_1																																													70.0%	56%	120bp	122bp	18%	98.7M	70.0%	56%	120bp	122bp	18%	98.7M
tih_rna_sample_00528_23LGNLLT4_1_trimmed_2																																													68.8%	56%	120bp	122bp	9%	98.7M	68.8%	56%	120bp	122bp	9%	98.7M
tih_rna_sample_00531_23LGNLLT4_1	No	0.00%	54800140	0.02	15980567	0.71	0	1	0.98	9.10	4.00	0	0	0.000	109.3bp	106.0bp	0.13%	0.61%	0.39%	0.00%	0.27%	1.93%	0.60%	0.00%	9999000000	20603048				110bp	139bp	72.4%	0.0%	82.3%	76.4%	91.6%	25.1M	42.8%	97.6%	5775.2Mb	54.8M	54.8%	90.5%	82.2%
tih_rna_sample_00531_23LGNLLT4_1_1																											109.3bp	80.7%	22.1M																74.9%	56%	151bp	151bp	45%	30.3M
tih_rna_sample_00531_23LGNLLT4_1_2																																													73.6%	58%	151bp	151bp	55%	30.3M
tih_rna_sample_00531_23LGNLLT4_1_trimmed_1																																													72.5%	54%	108bp	107bp	18%	27.4M	72.5%	54%	108bp	107bp	18%	27.4M
tih_rna_sample_00531_23LGNLLT4_1_trimmed_2																																													71.9%	54%	108bp	107bp	9%	27.4M	71.9%	54%	108bp	107bp	9%	27.4M
tih_rna_sample_00535_23LGNLLT4_1	No	0.00%	156383120	0.02	34866909	0.78	1	0	0.98	25.00	10.00	0	0	0.000	110.9bp	107.0bp	0.54%	1.25%	0.49%	0.00%	1.10%	3.69%	0.76%	0.00%	9999000000	37272214				109bp	136bp	79.3%	0.0%	89.8%	80.0%	92.3%	72.1M	48.0%	97.6%	16781.2Mb	156.4M	55.9%	95.7%	81.8%
tih_rna_sample_00535_23LGNLLT4_1_1																											110.9bp	87.8%	68.7M																80.2%	55%	151bp	151bp	45%	81.7M
tih_rna_sample_00535_23LGNLLT4_1_2																																													78.8%	57%	151bp	151bp	45%	81.7M
tih_rna_sample_00535_23LGNLLT4_1_trimmed_1																																													79.6%	55%	110bp	112bp	18%	78.2M	79.6%	55%	110bp	112bp	18%	78.2M
tih_rna_sample_00535_23LGNLLT4_1_trimmed_2																																													79.0%	56%	110bp	112bp	9%	78.2M	79.0%	56%	110bp	112bp	9%	78.2M
tih_rna_sample_00536_23LGNLLT4_1	No	0.00%	46561884	0.44	27208731	0.42	0	0	0.97	3.72	1.00	0	0	0.000	95.6bp	94.0bp	0.82%	1.29%	0.50%	0.00%	1.61%	3.48%	0.66%	0.00%	9999000000	9358922				90bp	99bp	74.4%	1.9%	65.9%	25.0%	41.6%	9.7M	43.4%	96.1%	3570.7Mb	46.6M	60.1%	92.2%	89.7%
tih_rna_sample_00536_23LGNLLT4_1_1																											95.6bp	37.2%	8.7M																84.0%	60%	151bp	151bp	45%	25.2M
tih_rna_sample_00536_23LGNLLT4_1_2																																													81.7%	62%	151bp	151bp	55%	25.2M
tih_rna_sample_00536_23LGNLLT4_1_trimmed_1																																													83.5%	59%	79bp	82bp	27%	23.3M	83.5%	59%	79bp	82bp	27%	23.3M
tih_rna_sample_00536_23LGNLLT4_1_trimmed_2																																													82.9%	60%	80bp	82bp	27%	23.3M	82.9%	60%	80bp	82bp	27%	23.3M
tih_rna_sample_00543_23LGNLLT4_1	No	0.00%	196145848	0.02	60572360	0.69	0	0	0.98	42.28	17.00	0	0	0.000	112.4bp	109.0bp	0.24%	0.58%	0.42%	0.00%	0.52%	1.80%	0.63%	0.00%	9999000000	84509932				113bp	140bp	70.3%	0.0%	84.7%	83.1%	93.2%	91.4M	45.1%	97.7%	21555.1Mb	196.1M	53.1%	98.1%	83.2%
tih_rna_sample_00543_23LGNLLT4_1_1																											112.4bp	84.5%	82.9M																74.6%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00543_23LGNLLT4_1_2																																													73.3%	53%	151bp	151bp	45%	100.0M
tih_rna_sample_00543_23LGNLLT4_1_trimmed_1																																													74.4%	53%	112bp	112bp	18%	98.1M	74.4%	53%	112bp	112bp	18%	98.1M
tih_rna_sample_00543_23LGNLLT4_1_trimmed_2																																													73.6%	53%	113bp	112bp	9%	98.1M	73.6%	53%	113bp	112bp	9%	98.1M
tih_rna_sample_00548_23LGNLLT4_1	Yes	10.24%	197112626	0.01	96741003	0.51	1	0	0.98	106.18	47.00	1	0	0.000	118.5bp	112.0bp	0.52%	1.23%	0.53%	0.00%	1.00%	3.56%	0.73%	0.00%	9990000000	156707249				116bp	153bp	51.5%	0.0%	86.6%	85.1%	94.4%	93.0M	32.6%	97.8%	22233.6Mb	197.1M	53.3%	98.6%	77.5%
tih_rna_sample_00548_23LGNLLT4_1_1																											118.5bp	86.4%	85.2M																69.8%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00548_23LGNLLT4_1_2																																													67.5%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00548_23LGNLLT4_1_trimmed_1																																													69.7%	53%	115bp	117bp	18%	98.6M	69.7%	53%	115bp	117bp	18%	98.6M
tih_rna_sample_00548_23LGNLLT4_1_trimmed_2																																													67.9%	53%	115bp	117bp	9%	98.6M	67.9%	53%	115bp	117bp	9%	98.6M
tih_rna_sample_00549_23LGNLLT4_1	No	0.00%	197174344	0.01	108402387	0.45	1	0	0.98	148.49	51.00	1	0	0.000	122.2bp	115.0bp	0.10%	0.67%	0.49%	0.00%	0.19%	1.94%	0.69%	0.00%	9999000000	196989658				125bp	195bp	45.6%	0.0%	92.9%	84.9%	94.1%	92.7M	28.3%	97.5%	22798.4Mb	197.2M	58.5%	98.6%	74.5%
tih_rna_sample_00549_23LGNLLT4_1_1																											122.2bp	92.5%	91.2M																73.0%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00549_23LGNLLT4_1_2																																													71.4%	57%	151bp	151bp	18%	100.0M
tih_rna_sample_00549_23LGNLLT4_1_trimmed_1																																													73.0%	58%	118bp	122bp	18%	98.6M	73.0%	58%	118bp	122bp	18%	98.6M
tih_rna_sample_00549_23LGNLLT4_1_trimmed_2																																													72.0%	58%	119bp	122bp	9%	98.6M	72.0%	58%	119bp	122bp	9%	98.6M
tih_rna_sample_00566_23LGNLLT4_1	No	0.00%	197957844	0.01	146394519	0.26	1	0	0.98	259.54	113.00	1	1	0.000	147.1bp	136.0bp	0.23%	1.29%	0.57%	0.00%	0.46%	4.04%	0.85%	0.00%	9999000000	402077705				170bp	360bp	26.2%	0.0%	93.6%	88.5%	95.5%	94.6M	17.0%	97.7%	25397.2Mb	198.0M	54.2%	99.0%	54.0%
tih_rna_sample_00566_23LGNLLT4_1_1																											147.1bp	93.7%	92.7M																68.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00566_23LGNLLT4_1_2																																													67.9%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00566_23LGNLLT4_1_trimmed_1																																													68.2%	54%	131bp	147bp	18%	99.0M	68.2%	54%	131bp	147bp	18%	99.0M
tih_rna_sample_00566_23LGNLLT4_1_trimmed_2																																													68.4%	54%	131bp	147bp	9%	99.0M	68.4%	54%	131bp	147bp	9%	99.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools	Reads	SeqTools Reads	`reads`	None
\|\|	Custom content: SeqTools	Frac Unmapped	SeqTools Frac Unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools	Unique Reads	SeqTools Unique Reads	`unique_reads`	None
\|\|	Custom content: SeqTools	Frac Dupes	SeqTools Frac Dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools	Frac Reads On Target	SeqTools Frac Reads On Target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools	Frac Reads Off Target	SeqTools Frac Reads Off Target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools	N Q30	SeqTools N Q30	`n_q30`	None
\|\|	Custom content: SeqTools	Mean Depth	SeqTools Mean Depth	`mean_depth`	None
\|\|	Custom content: SeqTools	Q50 Depth	SeqTools Q50 Depth	`q50_depth`	None
\|\|	Custom content: SeqTools	Frac Bases Gt30X	SeqTools Frac Bases Gt30X	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools	Frac Bases Gt100X	SeqTools Frac Bases Gt100X	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools	GC Bias	Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁷/₄₇ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_02_RNA_0011_23LGNLLT4_1	215.3M	0.0M	0.0M	16.3M	1.5M	191.1M	95.6M	95.5M	95.5M	95.5M	95.4M	95.7M	190.5M	0.0M
FFPE_V4_0001_RNA_0001_23LGNLLT4_1	214.2M	0.0M	0.0M	15.6M	1.2M	191.0M	95.6M	95.5M	95.5M	95.5M	95.3M	95.7M	190.5M	0.0M
NTC_0001_0001_23LGNLLT4_1	1.9M	0.0M	0.0M	1.5M	0.2M	0.1M	0.0M	0.0M	0.0M	0.0M	0.1M	0.0M	0.1M	0.0M
tih_rna_sample_00298_23LGNLLT4_1	218.2M	0.0M	0.0M	19.2M	2.3M	189.2M	94.7M	94.6M	94.6M	94.6M	102.4M	86.8M	188.6M	0.0M
tih_rna_sample_00303_23LGNLLT4_1	216.7M	0.0M	0.0M	17.6M	1.8M	189.7M	94.9M	94.8M	94.9M	94.8M	108.3M	81.4M	188.9M	0.0M
tih_rna_sample_00307_23LGNLLT4_1	212.8M	0.0M	0.0M	13.9M	1.2M	191.8M	95.9M	95.8M	95.9M	95.9M	102.5M	89.3M	191.2M	0.0M
tih_rna_sample_00308_23LGNLLT4_1	218.5M	0.0M	0.0M	19.8M	1.9M	189.5M	94.8M	94.7M	94.8M	94.7M	114.6M	75.0M	188.7M	0.0M
tih_rna_sample_00309_23LGNLLT4_1	217.8M	0.0M	0.0M	18.8M	1.7M	189.8M	95.0M	94.9M	94.9M	94.9M	105.7M	84.2M	189.2M	0.0M
tih_rna_sample_00312_23LGNLLT4_1	225.9M	0.0M	0.0M	27.3M	2.8M	186.0M	93.1M	92.9M	93.0M	93.0M	118.8M	67.1M	185.2M	0.0M
tih_rna_sample_00317_23LGNLLT4_1	219.1M	0.0M	0.0M	21.5M	2.2M	187.1M	93.6M	93.5M	93.6M	93.6M	112.3M	74.8M	186.2M	0.0M
tih_rna_sample_00319_23LGNLLT4_1	215.2M	0.0M	0.0M	16.3M	3.0M	189.2M	94.6M	94.5M	94.6M	94.6M	97.3M	91.9M	188.6M	0.0M
tih_rna_sample_00321_23LGNLLT4_1	223.3M	0.0M	0.0M	24.6M	2.5M	187.0M	93.6M	93.4M	93.5M	93.5M	109.7M	77.3M	186.3M	0.0M
tih_rna_sample_00322_23LGNLLT4_1	221.2M	0.0M	0.0M	22.6M	14.4M	175.9M	88.0M	87.9M	88.0M	87.9M	97.1M	78.8M	175.2M	0.0M
tih_rna_sample_00323_23LGNLLT4_1	220.3M	0.0M	0.0M	23.2M	2.9M	186.1M	93.1M	93.0M	93.1M	93.0M	122.0M	64.1M	185.5M	0.0M
tih_rna_sample_00331_23LGNLLT4_1	220.4M	0.0M	0.0M	22.5M	2.6M	187.2M	93.7M	93.5M	93.6M	93.6M	126.7M	60.6M	186.5M	0.0M
tih_rna_sample_00332_23LGNLLT4_1	221.9M	0.0M	0.0M	26.1M	4.2M	183.6M	91.9M	91.7M	91.9M	91.7M	82.1M	101.5M	182.7M	0.0M
tih_rna_sample_00341_23LGNLLT4_1	222.7M	0.0M	0.0M	24.6M	2.6M	186.6M	93.4M	93.2M	93.3M	93.3M	117.6M	69.0M	185.9M	0.0M
tih_rna_sample_00344_23LGNLLT4_1	218.0M	0.0M	0.0M	20.0M	2.3M	188.3M	94.2M	94.1M	94.1M	94.1M	114.4M	73.9M	187.5M	0.0M
tih_rna_sample_00345_23LGNLLT4_1	219.3M	0.0M	0.0M	20.7M	1.6M	189.6M	94.9M	94.8M	94.8M	94.8M	106.3M	83.4M	188.8M	0.0M
tih_rna_sample_00347_23LGNLLT4_1	215.9M	0.0M	0.0M	16.6M	1.4M	191.1M	95.5M	95.6M	95.5M	95.5M	103.3M	87.8M	190.3M	0.0M
tih_rna_sample_00348_23LGNLLT4_1	215.2M	0.0M	0.0M	16.6M	1.3M	191.1M	95.6M	95.5M	95.5M	95.5M	105.4M	85.7M	190.4M	0.0M
tih_rna_sample_00354_23LGNLLT4_1	234.4M	0.0M	0.0M	39.3M	20.0M	160.5M	80.3M	80.2M	80.2M	80.2M	112.8M	47.7M	159.9M	0.0M
tih_rna_sample_00355_23LGNLLT4_1	216.5M	0.0M	0.0M	17.6M	2.4M	189.4M	94.8M	94.6M	94.7M	94.7M	105.3M	84.1M	188.6M	0.0M
tih_rna_sample_00358_23LGNLLT4_1	220.2M	0.0M	0.0M	21.4M	2.5M	188.4M	94.3M	94.1M	94.2M	94.2M	121.3M	67.0M	187.5M	0.0M
tih_rna_sample_00360_23LGNLLT4_1	213.9M	0.0M	0.0M	17.4M	1.9M	188.1M	94.1M	94.0M	94.1M	94.1M	100.3M	87.9M	187.5M	0.0M
tih_rna_sample_00452_23LGNLLT4_1	215.7M	0.0M	0.0M	16.5M	1.3M	191.2M	95.6M	95.5M	95.6M	95.6M	108.8M	82.4M	190.5M	0.0M
tih_rna_sample_00477_23LGNLLT4_1	213.1M	0.0M	0.0M	14.1M	1.1M	192.3M	96.2M	96.1M	96.2M	96.2M	100.4M	91.9M	191.7M	0.0M
tih_rna_sample_00483_23LGNLLT4_1	220.8M	0.0M	0.0M	22.6M	2.4M	186.8M	93.4M	93.4M	93.4M	93.4M	107.0M	79.8M	186.1M	0.0M
tih_rna_sample_00485_23LGNLLT4_1	218.1M	0.0M	0.0M	19.0M	5.2M	185.3M	92.7M	92.6M	92.7M	92.7M	103.7M	81.6M	184.6M	0.0M
tih_rna_sample_00487_23LGNLLT4_1	223.5M	0.0M	0.0M	28.1M	4.0M	181.5M	90.9M	90.7M	90.8M	90.8M	110.9M	70.6M	180.8M	0.0M
tih_rna_sample_00494_23LGNLLT4_1	221.6M	0.0M	0.0M	24.1M	2.3M	186.8M	93.5M	93.3M	93.4M	93.4M	116.7M	70.2M	186.1M	0.0M
tih_rna_sample_00499_23LGNLLT4_1	212.7M	0.0M	0.0M	13.7M	1.1M	192.3M	96.2M	96.1M	96.1M	96.1M	106.3M	86.0M	191.6M	0.0M
tih_rna_sample_00500_23LGNLLT4_1	214.4M	0.0M	0.0M	15.3M	1.2M	191.7M	95.9M	95.8M	95.9M	95.9M	103.2M	88.6M	191.0M	0.0M
tih_rna_sample_00501_23LGNLLT4_1	221.3M	0.0M	0.0M	22.8M	1.9M	188.3M	94.2M	94.1M	94.1M	94.2M	111.2M	77.1M	187.6M	0.0M
tih_rna_sample_00505_23LGNLLT4_1	220.2M	0.0M	0.0M	24.1M	2.6M	184.8M	92.5M	92.3M	92.4M	92.4M	125.6M	59.2M	184.0M	0.0M
tih_rna_sample_00508_23LGNLLT4_1	215.2M	0.0M	0.0M	16.4M	1.4M	191.1M	95.6M	95.5M	95.5M	95.5M	104.9M	86.1M	190.4M	0.0M
tih_rna_sample_00509_23LGNLLT4_1	214.4M	0.0M	0.0M	15.5M	1.2M	191.5M	95.8M	95.7M	95.8M	95.8M	106.0M	85.5M	190.9M	0.0M
tih_rna_sample_00510_23LGNLLT4_1	223.5M	0.0M	0.0M	25.0M	2.2M	187.7M	93.8M	93.9M	93.8M	93.8M	122.3M	65.4M	186.7M	0.0M
tih_rna_sample_00512_23LGNLLT4_1	213.0M	0.0M	0.0M	13.6M	1.4M	192.8M	96.4M	96.4M	96.4M	96.4M	95.8M	97.0M	192.0M	0.0M
tih_rna_sample_00528_23LGNLLT4_1	221.4M	0.0M	0.0M	22.8M	2.1M	188.2M	94.1M	94.1M	94.1M	94.1M	119.9M	68.3M	187.4M	0.0M
tih_rna_sample_00531_23LGNLLT4_1	66.3M	0.0M	0.0M	11.1M	1.1M	50.9M	25.5M	25.4M	25.5M	25.4M	34.2M	16.7M	50.6M	0.0M
tih_rna_sample_00535_23LGNLLT4_1	182.0M	0.0M	0.0M	24.6M	3.1M	146.3M	73.2M	73.1M	73.1M	73.1M	98.7M	47.6M	145.6M	0.0M
tih_rna_sample_00536_23LGNLLT4_1	78.3M	0.0M	0.0M	31.3M	20.5M	19.7M	9.8M	9.8M	9.9M	9.8M	14.3M	5.4M	19.6M	0.0M
tih_rna_sample_00543_23LGNLLT4_1	222.1M	0.0M	0.0M	24.8M	3.3M	185.4M	92.8M	92.6M	92.7M	92.7M	123.2M	62.2M	184.6M	0.0M
tih_rna_sample_00548_23LGNLLT4_1	219.8M	0.0M	0.0M	21.9M	2.2M	187.8M	94.0M	93.8M	93.9M	93.9M	121.3M	66.5M	187.2M	0.0M
tih_rna_sample_00549_23LGNLLT4_1	220.1M	0.0M	0.0M	22.0M	2.6M	187.4M	93.8M	93.6M	93.7M	93.7M	110.2M	77.2M	186.7M	0.0M
tih_rna_sample_00566_23LGNLLT4_1	215.3M	0.0M	0.0M	16.4M	1.2M	191.2M	95.7M	95.6M	95.6M	95.6M	100.1M	91.2M	190.5M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	94	42290309	0.2400%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	7	671100	0.0038%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	7	713258	0.0040%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	6	368928	0.0021%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	5	343920	0.0020%
GTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCC	4	407259	0.0023%
GGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAAAC	4	146788	0.0008%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGGGTTTCGGTCCCGCCGC	4	217634	0.0012%
GGTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGC	3	135559	0.0008%
GGGGAAGGTGGCTCGGGGGGCC	2	223600	0.0013%
GGCCCCCCGAGCCACCTTCCCC	2	224799	0.0013%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGGGTTTCGGTCCCGCC	2	115177	0.0007%
GGGTCTCGCTCCCTCGGCCCCGGGATTCGGCGAGTGCTGCTGCCGGGGGG	2	90744	0.0005%
GGGTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCG	2	67149	0.0004%
GCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAAACC	2	66715	0.0004%
GGCGGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGA	2	65413	0.0004%
GGCGGCGGCGGCGGCGGCGGCGGGACCGAAACCCCCCCCGAGTGTTACAG	2	62682	0.0004%
GCGGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAA	2	61158	0.0003%
GGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAAACCCC	2	55238	0.0003%
GGGATTCCCTGGACCTAAAGGTGCTGCTGGAGAGCCCGGCAAGGCTGGAG	2	302764	0.0017%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	47	8567826	0.0980%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	334571	0.0038%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	350107	0.0040%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	182651	0.0021%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	3	172319	0.0020%
GGGGAAGGTGGCTCGGGGGGCC	2	223600	0.0026%
GGCCCCCCGAGCCACCTTCCCC	2	224799	0.0026%
GTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCC	2	202146	0.0023%
GGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAAAC	2	72983	0.0008%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGGGTTTCGGTCCCGCCGC	2	106209	0.0012%
GGTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGC	2	79106	0.0009%
AACCGAAACCGAAACCTA	2	1690	0.0000%
TAGGTTTCGGTTTCGGTT	2	1694	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	839	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAG	2	786	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	788	0.0000%
GCCCCCCCGGCAGCAGC	2	820	0.0000%
GGCCCCCCCGGCAGCAGC	2	822	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	797	0.0000%
GCTGCTGCCGGGGGGGCC	2	831	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER_SAME_GENE	awk	`filter same-gene (gene1==gene2)`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION_CRAM	samtools	`1.17`
SAMTOOLS_SORT_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_STARFUSION	samtools	`1.17`
SEQTK_SAMPLE	seqtk	`1.4.post122`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_FOR_ARRIBA	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
STAR_FOR_STARFUSION	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0005/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-095416' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,debugging -name dev_rna_exp0005_5f1fa79 --input 's3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260204_LH00166_0237_A23LGNLLT4__497a58ff--20260211-215120/samplesheets/rnaseq_samplesheetdev_rna_exp0005.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0005/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-095416' -resume 65644bf5-537f-44af-aee4-dc21c022df46

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0005_5f1fa79
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,debugging
configFiles: N/A

Input/output options

input: s3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260204_LH00166_0237_A23LGNLLT4__497a58ff--20260211-215120/samplesheets/rnaseq_samplesheetdev_rna_exp0005.csv
outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0005/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-095416
strand: unknown
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks