MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-06, 00:51 UTC based on data in: /tmp/nxf.6jL0ybDV4N

General Statistics

Showing ²⁴⁰/₂₄₀ rows and ⁴⁹/₅₆ columns.

Sample Name	Reads	Frac Unmapped	Unique Reads	Frac Dupes	Frac Reads On Target	Frac Reads Off Target	N Q30	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	RNA contaminated	RNA contamination %	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1	197650068	0.01	150029975	0.24	1	0	0.98	254.73	94.00	1	0	0.000	180.0bp	165.0bp	0.68%	1.53%	0.89%	0.00%	1.42%	4.41%	1.16%	0.00%	Yes	66.20%	9999000000	409929548				205bp	389bp	24.3%	0.0%	82.5%	85.0%	94.4%	93.3M	17.3%	97.9%	27201.1Mb	197.7M	53.9%	98.8%	33.2%
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_1																											180.0bp	81.5%	80.6M																62.6%	53%	151bp	151bp	27%	100.0M
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_2																																													61.1%	54%	151bp	151bp	18%	100.0M
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_trimmed_1																																													62.5%	53%	140bp	151bp	18%	98.8M	62.5%	53%	140bp	151bp	18%	98.8M
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1_trimmed_2																																													61.4%	54%	141bp	151bp	9%	98.8M	61.4%	54%	141bp	151bp	9%	98.8M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1	197237432	0.01	135243243	0.31	1	0	0.98	193.88	42.00	1	0	0.000	165.3bp	152.0bp	0.65%	1.56%	1.44%	0.00%	1.19%	4.22%	1.82%	0.00%	No	0.00%	9999000000	263510674				174bp	283bp	31.8%	0.0%	77.7%	83.5%	93.7%	92.4M	22.6%	98.0%	26412.8Mb	197.2M	53.3%	98.6%	42.1%
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_1																											165.3bp	75.5%	74.5M																62.4%	52%	151bp	151bp	36%	100.0M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_2																																													61.5%	53%	151bp	151bp	18%	100.0M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_trimmed_1																																													62.2%	53%	137bp	151bp	18%	98.6M	62.2%	53%	137bp	151bp	18%	98.6M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1_trimmed_2																																													61.9%	53%	137bp	151bp	9%	98.6M	61.9%	53%	137bp	151bp	9%	98.6M
NTC_0001_0001_23KKJ7LT4_1	811668	0.58	528774	0.35	0	0	0.92	0.00	0.00	0	0	0.000	40.6bp	31.0bp	0.01%	0.01%	0.00%	0.00%	0.02%	0.01%	0.00%	0.00%	Yes	100.00%	9999000000	103448				23bp	25bp	82.6%	1.7%	4.6%	2.8%	8.1%	0.0M	74.1%	93.7%	68.6Mb	0.8M	65.6%	6.6%	51.5%
NTC_0001_0001_23KKJ7LT4_1_1																											40.6bp	2.3%	0.0M																97.5%	74%	151bp	151bp	64%	6.2M
NTC_0001_0001_23KKJ7LT4_1_2																																													96.7%	96%	151bp	151bp	55%	6.2M
NTC_0001_0001_23KKJ7LT4_1_trimmed_1																																													66.3%	63%	89bp	97bp	36%	0.4M	66.3%	63%	89bp	97bp	36%	0.4M
NTC_0001_0001_23KKJ7LT4_1_trimmed_2																																													66.4%	67%	91bp	102bp	36%	0.4M	66.4%	67%	91bp	102bp	36%	0.4M
tih_rna_sample_00001_23KKJ7LT4_1	196614694	0.02	130605853	0.34	1	0	0.98	151.57	66.00	1	0	0.000	153.1bp	142.0bp	1.06%	0.71%	0.54%	0.00%	2.12%	2.17%	0.78%	0.00%	No	0.00%	9999000000	228398766				156bp	213bp	34.2%	0.0%	72.1%	82.4%	92.7%	91.1M	23.4%	98.0%	25820.3Mb	196.6M	52.1%	98.3%	48.6%
tih_rna_sample_00001_23KKJ7LT4_1_1																											153.1bp	71.5%	70.3M																56.3%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00001_23KKJ7LT4_1_2																																													55.3%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00001_23KKJ7LT4_1_trimmed_1																																													56.0%	51%	134bp	151bp	18%	98.3M	56.0%	51%	134bp	151bp	18%	98.3M
tih_rna_sample_00001_23KKJ7LT4_1_trimmed_2																																													55.5%	52%	134bp	151bp	9%	98.3M	55.5%	52%	134bp	151bp	9%	98.3M
tih_rna_sample_00002_23KKJ7LT4_1	197559678	0.01	149797439	0.24	1	0	0.98	155.59	82.00	1	0	0.000	149.7bp	140.0bp	0.64%	0.85%	0.46%	0.00%	1.48%	2.74%	0.64%	0.00%	No	0.00%	9999000000	342062621				151bp	187bp	24.4%	0.0%	63.6%	86.2%	94.6%	93.4M	17.1%	98.1%	25699.5Mb	197.6M	49.8%	98.8%	51.0%
tih_rna_sample_00002_23KKJ7LT4_1_1																											149.7bp	64.2%	63.5M																49.5%	49%	151bp	151bp	18%	100.0M
tih_rna_sample_00002_23KKJ7LT4_1_2																																													46.7%	50%	151bp	151bp	9%	100.0M
tih_rna_sample_00002_23KKJ7LT4_1_trimmed_1																																													49.3%	49%	133bp	147bp	9%	98.8M	49.3%	49%	133bp	147bp	9%	98.8M
tih_rna_sample_00002_23KKJ7LT4_1_trimmed_2																																													46.8%	50%	133bp	147bp	0%	98.8M	46.8%	50%	133bp	147bp	0%	98.8M
tih_rna_sample_00004_23KKJ7LT4_1	197545498	0.01	148771645	0.25	1	0	0.98	196.22	86.00	1	0	0.000	159.8bp	148.0bp	0.83%	0.61%	0.53%	0.00%	1.73%	1.87%	0.75%	0.00%	No	0.00%	9999000000	380814886				165bp	239bp	25.0%	0.0%	73.7%	84.8%	94.1%	93.0M	17.1%	98.1%	26237.6Mb	197.5M	51.9%	98.8%	44.3%
tih_rna_sample_00004_23KKJ7LT4_1_1																											159.8bp	72.9%	72.0M																56.3%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00004_23KKJ7LT4_1_2																																													54.0%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00004_23KKJ7LT4_1_trimmed_1																																													56.1%	51%	135bp	151bp	18%	98.8M	56.1%	51%	135bp	151bp	18%	98.8M
tih_rna_sample_00004_23KKJ7LT4_1_trimmed_2																																													54.3%	52%	135bp	151bp	9%	98.8M	54.3%	52%	135bp	151bp	9%	98.8M
tih_rna_sample_00005_23KKJ7LT4_1	187762428	0.03	81317412	0.57	0	0	0.98	61.21	23.00	0	0	0.000	131.1bp	125.0bp	0.93%	1.05%	0.75%	0.00%	1.83%	2.98%	0.99%	0.00%	No	0.00%	9999000000	84342365				130bp	166bp	58.4%	0.0%	73.3%	75.4%	90.2%	84.6M	38.4%	97.7%	22641.5Mb	187.8M	54.1%	93.9%	65.9%
tih_rna_sample_00005_23KKJ7LT4_1_1																											131.1bp	70.6%	66.3M																68.2%	54%	151bp	151bp	45%	100.0M
tih_rna_sample_00005_23KKJ7LT4_1_2																																													66.3%	56%	151bp	151bp	45%	100.0M
tih_rna_sample_00005_23KKJ7LT4_1_trimmed_1																																													66.4%	53%	123bp	132bp	18%	93.9M	66.4%	53%	123bp	132bp	18%	93.9M
tih_rna_sample_00005_23KKJ7LT4_1_trimmed_2																																													65.2%	54%	124bp	132bp	9%	93.9M	65.2%	54%	124bp	132bp	9%	93.9M
tih_rna_sample_00006_23KKJ7LT4_1	196965088	0.02	142695580	0.28	1	0	0.98	163.91	65.00	1	0	0.000	135.3bp	129.0bp	1.49%	1.25%	0.81%	0.00%	3.16%	3.60%	1.10%	0.00%	No	0.00%	9999000000	327079197				139bp	186bp	28.1%	0.0%	75.6%	80.0%	92.3%	90.9M	16.6%	97.9%	24460.6Mb	197.0M	53.9%	98.5%	61.6%
tih_rna_sample_00006_23KKJ7LT4_1_1																											135.3bp	74.0%	72.9M																56.1%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00006_23KKJ7LT4_1_2																																													54.5%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00006_23KKJ7LT4_1_trimmed_1																																													55.9%	53%	127bp	137bp	18%	98.5M	55.9%	53%	127bp	137bp	18%	98.5M
tih_rna_sample_00006_23KKJ7LT4_1_trimmed_2																																													54.8%	54%	127bp	137bp	9%	98.5M	54.8%	54%	127bp	137bp	9%	98.5M
tih_rna_sample_00007_23KKJ7LT4_1	196184146	0.01	143386838	0.27	1	0	0.98	164.55	79.00	1	0	0.000	154.5bp	145.0bp	0.95%	0.93%	0.63%	0.00%	2.06%	2.90%	0.86%	0.00%	No	0.00%	9999000000	306454184				153bp	199bp	27.3%	0.0%	69.4%	82.9%	93.2%	91.4M	18.5%	97.9%	25563.7Mb	196.2M	52.2%	98.1%	49.3%
tih_rna_sample_00007_23KKJ7LT4_1_1																											154.5bp	68.3%	67.0M																52.3%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00007_23KKJ7LT4_1_2																																													50.7%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00007_23KKJ7LT4_1_trimmed_1																																													51.8%	52%	133bp	151bp	18%	98.1M	51.8%	52%	133bp	151bp	18%	98.1M
tih_rna_sample_00007_23KKJ7LT4_1_trimmed_2																																													50.7%	52%	133bp	151bp	9%	98.1M	50.7%	52%	133bp	151bp	9%	98.1M
tih_rna_sample_00008_23KKJ7LT4_1	140156974	0.04	54450954	0.61	0	1	0.98	14.42	6.00	0	0	0.000	112.8bp	110.0bp	0.60%	0.52%	0.29%	0.00%	1.50%	1.61%	0.39%	0.00%	No	0.00%	9999000000	51898532				110bp	117bp	63.5%	0.0%	51.7%	73.0%	89.1%	62.4M	36.1%	97.3%	14976.1Mb	140.2M	51.6%	91.4%	80.2%
tih_rna_sample_00008_23KKJ7LT4_1_1																											112.8bp	49.9%	35.0M																66.2%	54%	151bp	151bp	36%	76.7M
tih_rna_sample_00008_23KKJ7LT4_1_2																																													65.2%	55%	151bp	151bp	55%	76.7M
tih_rna_sample_00008_23KKJ7LT4_1_trimmed_1																																													63.3%	51%	110bp	112bp	18%	70.1M	63.3%	51%	110bp	112bp	18%	70.1M
tih_rna_sample_00008_23KKJ7LT4_1_trimmed_2																																													62.8%	51%	110bp	112bp	9%	70.1M	62.8%	51%	110bp	112bp	9%	70.1M
tih_rna_sample_00009_23KKJ7LT4_1	194873238	0.04	128772085	0.34	1	0	0.98	134.35	44.00	1	0	0.000	140.0bp	133.0bp	0.98%	1.30%	0.79%	0.00%	2.02%	3.72%	1.10%	0.00%	No	0.00%	9999000000	230133659				140bp	176bp	35.3%	0.0%	73.9%	74.8%	88.9%	86.7M	22.0%	97.6%	24261.1Mb	194.9M	58.2%	97.4%	60.2%
tih_rna_sample_00009_23KKJ7LT4_1_1																											140.0bp	70.9%	69.1M																60.1%	57%	151bp	151bp	27%	100.0M
tih_rna_sample_00009_23KKJ7LT4_1_2																																													58.2%	58%	151bp	151bp	36%	100.0M
tih_rna_sample_00009_23KKJ7LT4_1_trimmed_1																																													59.6%	58%	127bp	137bp	18%	97.4M	59.6%	58%	127bp	137bp	18%	97.4M
tih_rna_sample_00009_23KKJ7LT4_1_trimmed_2																																													58.4%	58%	128bp	137bp	9%	97.4M	58.4%	58%	128bp	137bp	9%	97.4M
tih_rna_sample_00010_23KKJ7LT4_1	197610804	0.01	142692408	0.28	1	0	0.98	180.63	77.00	1	0	0.000	144.8bp	137.0bp	0.55%	0.62%	0.75%	0.00%	1.29%	2.00%	1.02%	0.00%	No	0.00%	9999000000	348556210				151bp	223bp	28.2%	0.0%	77.4%	86.0%	94.4%	93.2M	18.2%	98.0%	25469.8Mb	197.6M	52.3%	98.8%	54.8%
tih_rna_sample_00010_23KKJ7LT4_1_1																											144.8bp	76.6%	75.7M																58.2%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00010_23KKJ7LT4_1_2																																													56.3%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00010_23KKJ7LT4_1_trimmed_1																																													58.0%	52%	131bp	142bp	18%	98.8M	58.0%	52%	131bp	142bp	18%	98.8M
tih_rna_sample_00010_23KKJ7LT4_1_trimmed_2																																													56.6%	52%	132bp	142bp	9%	98.8M	56.6%	52%	132bp	142bp	9%	98.8M
tih_rna_sample_00012_23KKJ7LT4_1	196562320	0.02	136846483	0.30	1	0	0.98	142.02	61.00	1	0	0.000	135.5bp	129.0bp	0.60%	0.89%	0.67%	0.00%	1.37%	2.95%	0.95%	0.00%	No	0.00%	9999000000	284506721				139bp	181bp	31.0%	0.0%	72.1%	82.5%	92.8%	91.2M	18.8%	97.9%	24414.7Mb	196.6M	53.1%	98.3%	61.8%
tih_rna_sample_00012_23KKJ7LT4_1_1																											135.5bp	71.0%	69.8M																54.2%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00012_23KKJ7LT4_1_2																																													52.7%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00012_23KKJ7LT4_1_trimmed_1																																													53.9%	52%	127bp	137bp	18%	98.3M	53.9%	52%	127bp	137bp	18%	98.3M
tih_rna_sample_00012_23KKJ7LT4_1_trimmed_2																																													52.9%	53%	127bp	137bp	9%	98.3M	52.9%	53%	127bp	137bp	9%	98.3M
tih_rna_sample_00013_23KKJ7LT4_1	195560934	0.02	115593503	0.41	0	0	0.98	97.53	44.00	1	0	0.000	138.3bp	132.0bp	0.63%	0.87%	0.55%	0.00%	1.41%	2.78%	0.79%	0.00%	No	0.00%	9999000000	172252783				138bp	166bp	41.9%	0.0%	67.4%	80.4%	92.1%	90.0M	26.9%	97.7%	24446.0Mb	195.6M	53.4%	97.8%	61.2%
tih_rna_sample_00013_23KKJ7LT4_1_1																											138.3bp	65.9%	64.5M																56.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00013_23KKJ7LT4_1_2																																													54.3%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00013_23KKJ7LT4_1_trimmed_1																																													55.8%	53%	128bp	137bp	18%	97.8M	55.8%	53%	128bp	137bp	18%	97.8M
tih_rna_sample_00013_23KKJ7LT4_1_trimmed_2																																													54.4%	53%	128bp	137bp	9%	97.8M	54.4%	53%	128bp	137bp	9%	97.8M
tih_rna_sample_00015_23KKJ7LT4_1	197580614	0.01	136353950	0.31	1	0	0.98	175.47	83.00	1	0	0.000	158.7bp	147.0bp	0.95%	0.45%	0.44%	0.00%	2.33%	1.55%	0.66%	0.00%	No	0.00%	9999000000	324265950				175bp	274bp	31.3%	0.0%	74.2%	85.1%	94.2%	93.1M	20.8%	97.8%	26231.2Mb	197.6M	53.7%	98.8%	44.5%
tih_rna_sample_00015_23KKJ7LT4_1_1																											158.7bp	73.6%	72.7M																57.4%	53%	151bp	151bp	36%	100.0M
tih_rna_sample_00015_23KKJ7LT4_1_2																																													55.8%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00015_23KKJ7LT4_1_trimmed_1																																													57.3%	53%	136bp	151bp	27%	98.8M	57.3%	53%	136bp	151bp	27%	98.8M
tih_rna_sample_00015_23KKJ7LT4_1_trimmed_2																																													56.0%	53%	136bp	151bp	18%	98.8M	56.0%	53%	136bp	151bp	18%	98.8M
tih_rna_sample_00016_23KKJ7LT4_1	192046914	0.04	102211391	0.47	0	1	0.98	59.56	23.00	0	0	0.000	128.5bp	123.0bp	1.02%	1.10%	0.45%	0.00%	2.50%	3.47%	0.68%	0.00%	No	0.00%	9999000000	131489598				126bp	143bp	48.5%	0.0%	62.4%	74.1%	89.3%	85.7M	30.3%	97.4%	22746.7Mb	192.0M	54.9%	96.0%	69.4%
tih_rna_sample_00016_23KKJ7LT4_1_1																											128.5bp	60.4%	58.0M																59.4%	54%	151bp	151bp	36%	100.0M
tih_rna_sample_00016_23KKJ7LT4_1_2																																													57.9%	56%	151bp	151bp	36%	100.0M
tih_rna_sample_00016_23KKJ7LT4_1_trimmed_1																																													58.3%	54%	121bp	127bp	18%	96.0M	58.3%	54%	121bp	127bp	18%	96.0M
tih_rna_sample_00016_23KKJ7LT4_1_trimmed_2																																													57.4%	55%	122bp	127bp	9%	96.0M	57.4%	55%	122bp	127bp	9%	96.0M
tih_rna_sample_00020_23KKJ7LT4_1	196549750	0.02	138983467	0.29	1	0	0.98	165.50	71.00	1	0	0.000	139.6bp	132.0bp	1.49%	0.90%	0.62%	0.00%	3.10%	2.72%	0.84%	0.00%	No	0.00%	9999000000	289739892				140bp	185bp	29.8%	0.0%	76.6%	81.7%	92.9%	91.3M	18.5%	97.8%	24570.3Mb	196.5M	55.3%	98.3%	59.8%
tih_rna_sample_00020_23KKJ7LT4_1_1																											139.6bp	75.1%	73.8M																57.5%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00020_23KKJ7LT4_1_2																																													56.1%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00020_23KKJ7LT4_1_trimmed_1																																													57.3%	55%	128bp	137bp	18%	98.3M	57.3%	55%	128bp	137bp	18%	98.3M
tih_rna_sample_00020_23KKJ7LT4_1_trimmed_2																																													56.4%	55%	128bp	137bp	9%	98.3M	56.4%	55%	128bp	137bp	9%	98.3M
tih_rna_sample_00021_23KKJ7LT4_1	197310424	0.01	139547116	0.29	1	0	0.98	193.12	78.00	1	0	0.000	160.3bp	150.0bp	0.69%	1.30%	0.68%	0.00%	1.46%	3.94%	0.94%	0.00%	No	0.00%	9999000000	277461045				166bp	247bp	29.6%	0.0%	77.0%	83.4%	93.9%	92.6M	20.8%	97.9%	26359.8Mb	197.3M	53.8%	98.7%	44.2%
tih_rna_sample_00021_23KKJ7LT4_1_1																											160.3bp	76.1%	75.1M																59.0%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00021_23KKJ7LT4_1_2																																													58.0%	54%	151bp	151bp	18%	100.0M
tih_rna_sample_00021_23KKJ7LT4_1_trimmed_1																																													58.9%	53%	136bp	151bp	18%	98.7M	58.9%	53%	136bp	151bp	18%	98.7M
tih_rna_sample_00021_23KKJ7LT4_1_trimmed_2																																													58.3%	54%	136bp	151bp	9%	98.7M	58.3%	54%	136bp	151bp	9%	98.7M
tih_rna_sample_00022_23KKJ7LT4_1	195800900	0.02	126170524	0.36	1	0	0.98	152.64	55.00	1	0	0.000	144.3bp	136.0bp	0.83%	0.57%	0.62%	0.00%	1.71%	1.74%	0.86%	0.00%	No	0.00%	9999000000	232939668				147bp	206bp	36.3%	0.0%	78.9%	82.1%	92.7%	90.7M	22.2%	97.8%	24848.2Mb	195.8M	57.0%	97.9%	56.5%
tih_rna_sample_00022_23KKJ7LT4_1_1																											144.3bp	76.5%	74.9M																58.2%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00022_23KKJ7LT4_1_2																																													56.6%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00022_23KKJ7LT4_1_trimmed_1																																													57.8%	56%	130bp	142bp	18%	97.9M	57.8%	56%	130bp	142bp	18%	97.9M
tih_rna_sample_00022_23KKJ7LT4_1_trimmed_2																																													56.7%	57%	130bp	142bp	9%	97.9M	56.7%	57%	130bp	142bp	9%	97.9M
tih_rna_sample_00023_23KKJ7LT4_1	197448534	0.01	148214239	0.25	1	0	0.98	167.03	78.00	1	0	0.000	147.8bp	140.0bp	1.31%	0.56%	0.58%	0.00%	2.98%	1.73%	0.79%	0.00%	No	0.00%	9999000000	354920896				149bp	190bp	25.2%	0.0%	68.6%	84.2%	93.8%	92.6M	17.8%	98.1%	25553.5Mb	197.4M	50.4%	98.7%	51.8%
tih_rna_sample_00023_23KKJ7LT4_1_1																											147.8bp	67.1%	66.2M																54.3%	50%	151bp	151bp	27%	100.0M
tih_rna_sample_00023_23KKJ7LT4_1_2																																													52.1%	51%	151bp	151bp	18%	100.0M
tih_rna_sample_00023_23KKJ7LT4_1_trimmed_1																																													54.2%	50%	132bp	147bp	18%	98.7M	54.2%	50%	132bp	147bp	18%	98.7M
tih_rna_sample_00023_23KKJ7LT4_1_trimmed_2																																													52.2%	50%	132bp	147bp	9%	98.7M	52.2%	50%	132bp	147bp	9%	98.7M
tih_rna_sample_00024_23KKJ7LT4_1	195827094	0.03	131136750	0.33	1	0	0.98	134.89	45.00	1	0	0.000	131.0bp	125.0bp	0.93%	1.23%	0.74%	0.00%	2.00%	3.59%	1.02%	0.00%	No	0.00%	9999000000	241388438				132bp	167bp	34.1%	0.0%	74.6%	76.2%	90.1%	88.2M	20.2%	97.6%	23657.7Mb	195.8M	57.6%	97.9%	66.3%
tih_rna_sample_00024_23KKJ7LT4_1_1																											131.0bp	71.7%	70.2M																57.5%	56%	151bp	151bp	27%	100.0M
tih_rna_sample_00024_23KKJ7LT4_1_2																																													56.2%	57%	151bp	151bp	36%	100.0M
tih_rna_sample_00024_23KKJ7LT4_1_trimmed_1																																													57.0%	57%	124bp	132bp	18%	97.9M	57.0%	57%	124bp	132bp	18%	97.9M
tih_rna_sample_00024_23KKJ7LT4_1_trimmed_2																																													56.3%	57%	124bp	132bp	9%	97.9M	56.3%	57%	124bp	132bp	9%	97.9M
tih_rna_sample_00025_23KKJ7LT4_1	197236938	0.01	140053822	0.29	1	0	0.98	132.34	55.00	1	0	0.000	130.0bp	123.0bp	2.03%	2.34%	0.97%	0.00%	4.12%	6.68%	1.30%	0.00%	No	0.00%	9999000000	292763724				129bp	161bp	29.4%	0.0%	68.9%	83.8%	93.8%	92.5M	17.5%	98.0%	23848.4Mb	197.2M	49.1%	98.6%	67.2%
tih_rna_sample_00025_23KKJ7LT4_1_1																											130.0bp	68.3%	67.4M																54.8%	49%	151bp	151bp	27%	100.0M
tih_rna_sample_00025_23KKJ7LT4_1_2																																													51.4%	50%	151bp	151bp	18%	100.0M
tih_rna_sample_00025_23KKJ7LT4_1_trimmed_1																																													54.6%	48%	123bp	127bp	18%	98.6M	54.6%	48%	123bp	127bp	18%	98.6M
tih_rna_sample_00025_23KKJ7LT4_1_trimmed_2																																													51.7%	49%	123bp	127bp	9%	98.6M	51.7%	49%	123bp	127bp	9%	98.6M
tih_rna_sample_00027_23KKJ7LT4_1	197287768	0.01	143651805	0.27	1	0	0.98	134.08	52.00	1	0	0.000	139.1bp	131.0bp	0.86%	0.66%	0.42%	0.00%	1.97%	2.11%	0.56%	0.00%	No	0.00%	9990000000	320462614				138bp	167bp	27.5%	0.0%	64.3%	86.4%	94.7%	93.4M	17.5%	98.1%	24691.6Mb	197.3M	49.0%	98.6%	59.7%
tih_rna_sample_00027_23KKJ7LT4_1_1																											139.1bp	64.2%	63.3M																53.2%	49%	151bp	151bp	27%	100.0M
tih_rna_sample_00027_23KKJ7LT4_1_2																																													50.2%	50%	151bp	151bp	18%	100.0M
tih_rna_sample_00027_23KKJ7LT4_1_trimmed_1																																													53.0%	48%	128bp	137bp	18%	98.6M	53.0%	48%	128bp	137bp	18%	98.6M
tih_rna_sample_00027_23KKJ7LT4_1_trimmed_2																																													50.4%	49%	128bp	137bp	9%	98.6M	50.4%	49%	128bp	137bp	9%	98.6M
tih_rna_sample_00030_23KKJ7LT4_1	197489044	0.01	145563380	0.26	1	0	0.98	194.24	83.00	1	0	0.000	152.9bp	142.0bp	0.70%	0.93%	0.69%	0.00%	1.57%	2.98%	0.94%	0.00%	No	0.00%	9999000000	359973874				157bp	232bp	26.6%	0.0%	77.0%	86.8%	94.7%	93.6M	17.9%	98.1%	25857.1Mb	197.5M	52.7%	98.7%	49.4%
tih_rna_sample_00030_23KKJ7LT4_1_1																											152.9bp	75.7%	74.8M																58.5%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00030_23KKJ7LT4_1_2																																													56.8%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00030_23KKJ7LT4_1_trimmed_1																																													58.4%	52%	133bp	151bp	18%	98.7M	58.4%	52%	133bp	151bp	18%	98.7M
tih_rna_sample_00030_23KKJ7LT4_1_trimmed_2																																													57.1%	52%	134bp	151bp	9%	98.7M	57.1%	52%	134bp	151bp	9%	98.7M
tih_rna_sample_00032_23KKJ7LT4_1	197583394	0.01	144395152	0.27	1	0	0.98	200.17	85.00	1	0	0.000	158.3bp	145.0bp	2.81%	1.11%	0.67%	0.00%	5.87%	3.27%	0.89%	0.00%	No	0.00%	9999000000	332776237				165bp	254bp	27.2%	0.0%	77.2%	86.0%	94.7%	93.6M	18.6%	98.1%	26113.6Mb	197.6M	52.1%	98.8%	45.5%
tih_rna_sample_00032_23KKJ7LT4_1_1																											158.3bp	76.5%	75.6M																59.9%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00032_23KKJ7LT4_1_2																																													57.0%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00032_23KKJ7LT4_1_trimmed_1																																													59.8%	51%	135bp	151bp	18%	98.8M	59.8%	51%	135bp	151bp	18%	98.8M
tih_rna_sample_00032_23KKJ7LT4_1_trimmed_2																																													57.3%	52%	135bp	151bp	9%	98.8M	57.3%	52%	135bp	151bp	9%	98.8M
tih_rna_sample_00034_23KKJ7LT4_1	194068294	0.06	123845210	0.36	1	0	0.98	121.65	25.00	0	0	0.000	130.9bp	126.0bp	0.71%	0.73%	0.45%	0.00%	1.41%	2.07%	0.66%	0.00%	No	0.00%	9999000000	205032384				129bp	156bp	38.4%	0.0%	75.8%	70.1%	86.3%	83.7M	21.8%	97.1%	23167.4Mb	194.1M	61.3%	97.0%	68.0%
tih_rna_sample_00034_23KKJ7LT4_1_1																											130.9bp	70.9%	68.8M																61.9%	59%	151bp	151bp	27%	100.0M
tih_rna_sample_00034_23KKJ7LT4_1_2																																													60.0%	60%	151bp	151bp	27%	100.0M
tih_rna_sample_00034_23KKJ7LT4_1_trimmed_1																																													61.3%	61%	123bp	127bp	18%	97.0M	61.3%	61%	123bp	127bp	18%	97.0M
tih_rna_sample_00034_23KKJ7LT4_1_trimmed_2																																													60.5%	61%	123bp	127bp	9%	97.0M	60.5%	61%	123bp	127bp	9%	97.0M
tih_rna_sample_00035_23KKJ7LT4_1	195652504	0.01	122589572	0.37	1	0	0.98	120.80	51.00	1	0	0.000	135.3bp	127.0bp	0.80%	0.94%	0.72%	0.00%	1.64%	2.81%	0.97%	0.00%	No	0.00%	9999000000	198811069				132bp	168bp	37.9%	0.0%	72.7%	84.7%	94.1%	92.1M	24.8%	98.0%	24001.8Mb	195.7M	51.5%	97.8%	64.0%
tih_rna_sample_00035_23KKJ7LT4_1_1																											135.3bp	71.7%	70.2M																59.4%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00035_23KKJ7LT4_1_2																																													56.1%	52%	151bp	151bp	36%	100.0M
tih_rna_sample_00035_23KKJ7LT4_1_trimmed_1																																													58.9%	51%	125bp	132bp	18%	97.8M	58.9%	51%	125bp	132bp	18%	97.8M
tih_rna_sample_00035_23KKJ7LT4_1_trimmed_2																																													56.2%	51%	125bp	132bp	9%	97.8M	56.2%	51%	125bp	132bp	9%	97.8M
tih_rna_sample_00036_23KKJ7LT4_1	194444326	0.03	106889317	0.45	0	1	0.98	59.07	24.00	0	0	0.000	122.4bp	118.0bp	1.23%	1.22%	0.57%	0.00%	2.78%	3.62%	0.77%	0.00%	No	0.00%	9999000000	143035740				121bp	135bp	46.4%	0.0%	61.6%	77.4%	90.9%	88.4M	27.9%	97.7%	22586.6Mb	194.4M	52.8%	97.2%	75.1%
tih_rna_sample_00036_23KKJ7LT4_1_1																											122.4bp	59.9%	58.2M																55.3%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00036_23KKJ7LT4_1_2																																													53.7%	53%	151bp	151bp	36%	100.0M
tih_rna_sample_00036_23KKJ7LT4_1_trimmed_1																																													54.6%	52%	119bp	122bp	18%	97.2M	54.6%	52%	119bp	122bp	18%	97.2M
tih_rna_sample_00036_23KKJ7LT4_1_trimmed_2																																													53.6%	52%	119bp	122bp	9%	97.2M	53.6%	52%	119bp	122bp	9%	97.2M
tih_rna_sample_00037_23KKJ7LT4_1	197705414	0.01	157691699	0.20	1	0	0.98	205.59	101.00	1	1	0.000	156.0bp	144.0bp	0.83%	0.94%	0.56%	0.00%	1.85%	3.05%	0.77%	0.00%	No	0.00%	9999000000	488658952				157bp	221bp	20.5%	0.0%	73.1%	86.4%	94.5%	93.5M	14.1%	98.1%	25905.2Mb	197.7M	51.3%	98.9%	47.3%
tih_rna_sample_00037_23KKJ7LT4_1_1																											156.0bp	72.7%	71.9M																55.8%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00037_23KKJ7LT4_1_2																																													52.6%	51%	151bp	151bp	18%	100.0M
tih_rna_sample_00037_23KKJ7LT4_1_trimmed_1																																													55.6%	51%	134bp	151bp	18%	98.9M	55.6%	51%	134bp	151bp	18%	98.9M
tih_rna_sample_00037_23KKJ7LT4_1_trimmed_2																																													52.8%	51%	134bp	151bp	9%	98.9M	52.8%	51%	134bp	151bp	9%	98.9M
tih_rna_sample_00039_23KKJ7LT4_1	196779384	0.02	137174493	0.30	1	0	0.98	147.47	68.00	1	0	0.000	138.0bp	129.0bp	3.52%	1.29%	0.75%	0.00%	7.25%	3.79%	0.96%	0.00%	No	0.00%	9999000000	279042992				136bp	176bp	30.9%	0.0%	73.3%	81.9%	92.8%	91.3M	19.4%	98.0%	24450.9Mb	196.8M	52.0%	98.4%	61.2%
tih_rna_sample_00039_23KKJ7LT4_1_1																											138.0bp	72.3%	71.1M																57.3%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00039_23KKJ7LT4_1_2																																													53.6%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00039_23KKJ7LT4_1_trimmed_1																																													57.0%	51%	127bp	137bp	18%	98.4M	57.0%	51%	127bp	137bp	18%	98.4M
tih_rna_sample_00039_23KKJ7LT4_1_trimmed_2																																													53.8%	52%	127bp	137bp	9%	98.4M	53.8%	52%	127bp	137bp	9%	98.4M
tih_rna_sample_00041_23KKJ7LT4_1	196440044	0.01	130362180	0.34	1	0	0.98	129.62	56.00	1	0	0.000	142.1bp	132.0bp	0.99%	0.66%	0.41%	0.00%	2.12%	2.03%	0.56%	0.00%	No	0.00%	9999000000	234665884				141bp	180bp	34.1%	0.0%	68.0%	83.5%	93.7%	92.0M	22.5%	98.0%	24711.8Mb	196.4M	52.3%	98.2%	57.3%
tih_rna_sample_00041_23KKJ7LT4_1_1																											142.1bp	67.1%	65.9M																58.6%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00041_23KKJ7LT4_1_2																																													54.8%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00041_23KKJ7LT4_1_trimmed_1																																													58.2%	52%	128bp	142bp	18%	98.2M	58.2%	52%	128bp	142bp	18%	98.2M
tih_rna_sample_00041_23KKJ7LT4_1_trimmed_2																																													55.0%	52%	128bp	142bp	9%	98.2M	55.0%	52%	128bp	142bp	9%	98.2M
tih_rna_sample_00042_23KKJ7LT4_1	196509612	0.01	139302937	0.29	1	0	0.98	144.71	65.00	1	0	0.000	137.7bp	129.0bp	2.30%	0.94%	0.56%	0.00%	5.02%	2.76%	0.74%	0.00%	No	0.00%	9999000000	278753358				136bp	172bp	29.5%	0.0%	69.5%	84.2%	94.2%	92.5M	19.1%	98.0%	24380.4Mb	196.5M	51.3%	98.3%	60.6%
tih_rna_sample_00042_23KKJ7LT4_1_1																											137.7bp	69.0%	67.8M																55.5%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00042_23KKJ7LT4_1_2																																													52.3%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00042_23KKJ7LT4_1_trimmed_1																																													55.2%	51%	127bp	137bp	18%	98.3M	55.2%	51%	127bp	137bp	18%	98.3M
tih_rna_sample_00042_23KKJ7LT4_1_trimmed_2																																													52.4%	51%	127bp	137bp	9%	98.3M	52.4%	51%	127bp	137bp	9%	98.3M
tih_rna_sample_00043_23KKJ7LT4_1	196969296	0.01	133879364	0.32	1	0	0.98	139.26	63.00	1	0	0.000	138.8bp	130.0bp	1.11%	0.74%	0.50%	0.00%	2.63%	2.45%	0.69%	0.00%	No	0.00%	9999000000	270014373				141bp	190bp	32.4%	0.0%	70.5%	86.1%	94.8%	93.3M	20.8%	98.0%	24608.0Mb	197.0M	51.1%	98.5%	59.1%
tih_rna_sample_00043_23KKJ7LT4_1_1																											138.8bp	70.0%	68.9M																59.0%	50%	151bp	151bp	27%	100.0M
tih_rna_sample_00043_23KKJ7LT4_1_2																																													54.7%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00043_23KKJ7LT4_1_trimmed_1																																													58.7%	50%	127bp	137bp	18%	98.5M	58.7%	50%	127bp	137bp	18%	98.5M
tih_rna_sample_00043_23KKJ7LT4_1_trimmed_2																																													54.9%	51%	127bp	137bp	9%	98.5M	54.9%	51%	127bp	137bp	9%	98.5M
tih_rna_sample_00170_23KKJ7LT4_1	197524834	0.01	148686886	0.25	0	1	0.98	99.28	51.00	1	0	0.000	126.4bp	121.0bp	0.56%	0.89%	0.45%	0.00%	1.26%	2.74%	0.60%	0.00%	No	0.00%	9999000000	306589561				124bp	137bp	25.0%	0.0%	53.0%	84.1%	93.9%	92.7M	15.1%	98.2%	23336.0Mb	197.5M	48.0%	98.8%	70.5%
tih_rna_sample_00170_23KKJ7LT4_1_1																											126.4bp	53.5%	52.9M																44.6%	48%	151bp	151bp	18%	100.0M
tih_rna_sample_00170_23KKJ7LT4_1_2																																													40.2%	49%	151bp	151bp	18%	100.0M
tih_rna_sample_00170_23KKJ7LT4_1_trimmed_1																																													44.3%	47%	120bp	127bp	18%	98.8M	44.3%	47%	120bp	127bp	18%	98.8M
tih_rna_sample_00170_23KKJ7LT4_1_trimmed_2																																													40.2%	48%	120bp	127bp	9%	98.8M	40.2%	48%	120bp	127bp	9%	98.8M
tih_rna_sample_00176_23KKJ7LT4_1	191020120	0.05	90660734	0.53	0	0	0.98	70.56	17.00	0	0	0.000	132.6bp	127.0bp	0.84%	0.48%	0.33%	0.00%	1.83%	1.48%	0.51%	0.00%	No	0.00%	9999000000	109428299				133bp	159bp	55.1%	0.0%	73.7%	70.6%	87.2%	83.2M	34.2%	97.2%	23038.6Mb	191.0M	59.0%	95.5%	65.6%
tih_rna_sample_00176_23KKJ7LT4_1_1																											132.6bp	69.4%	66.3M																67.8%	58%	151bp	151bp	36%	100.0M
tih_rna_sample_00176_23KKJ7LT4_1_2																																													66.1%	59%	151bp	151bp	36%	100.0M
tih_rna_sample_00176_23KKJ7LT4_1_trimmed_1																																													66.8%	58%	124bp	132bp	18%	95.5M	66.8%	58%	124bp	132bp	18%	95.5M
tih_rna_sample_00176_23KKJ7LT4_1_trimmed_2																																													65.8%	59%	124bp	132bp	9%	95.5M	65.8%	59%	124bp	132bp	9%	95.5M
tih_rna_sample_00179_23KKJ7LT4_1	196047088	0.02	125831586	0.36	1	0	0.98	151.72	61.00	1	0	0.000	142.3bp	134.0bp	1.57%	1.11%	0.67%	0.00%	3.40%	3.34%	0.92%	0.00%	No	0.00%	9999000000	214316935				143bp	197bp	36.7%	0.0%	79.2%	76.9%	90.8%	89.0M	23.3%	97.7%	24629.0Mb	196.0M	55.0%	98.0%	58.1%
tih_rna_sample_00179_23KKJ7LT4_1_1																											142.3bp	76.7%	75.2M																62.3%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00179_23KKJ7LT4_1_2																																													60.0%	55%	151bp	151bp	18%	100.0M
tih_rna_sample_00179_23KKJ7LT4_1_trimmed_1																																													62.0%	54%	128bp	137bp	18%	98.0M	62.0%	54%	128bp	137bp	18%	98.0M
tih_rna_sample_00179_23KKJ7LT4_1_trimmed_2																																													60.4%	55%	129bp	142bp	9%	98.0M	60.4%	55%	129bp	142bp	9%	98.0M
tih_rna_sample_00180_23KKJ7LT4_1	196462978	0.03	133359678	0.32	1	0	0.98	171.02	40.00	1	0	0.000	142.1bp	134.0bp	0.38%	0.82%	0.51%	0.00%	0.82%	2.45%	0.75%	0.00%	No	0.00%	9999000000	274324928				144bp	194bp	33.2%	0.0%	80.7%	74.6%	89.4%	87.8M	20.1%	97.3%	24719.6Mb	196.5M	61.1%	98.2%	58.0%
tih_rna_sample_00180_23KKJ7LT4_1_1																											142.1bp	77.3%	75.9M																63.6%	59%	151bp	151bp	27%	100.0M
tih_rna_sample_00180_23KKJ7LT4_1_2																																													62.5%	60%	151bp	151bp	27%	100.0M
tih_rna_sample_00180_23KKJ7LT4_1_trimmed_1																																													63.4%	60%	129bp	142bp	18%	98.2M	63.4%	60%	129bp	142bp	18%	98.2M
tih_rna_sample_00180_23KKJ7LT4_1_trimmed_2																																													63.1%	61%	129bp	142bp	9%	98.2M	63.1%	61%	129bp	142bp	9%	98.2M
tih_rna_sample_00183_23KKJ7LT4_1	194917954	0.02	130499121	0.33	1	0	0.98	124.95	55.00	1	0	0.000	133.8bp	127.0bp	1.93%	0.74%	0.69%	0.00%	3.81%	2.12%	0.91%	0.00%	No	0.00%	9999000000	235645436				132bp	163bp	33.7%	0.0%	69.6%	79.9%	92.3%	90.0M	21.3%	97.8%	23735.7Mb	194.9M	52.3%	97.5%	64.0%
tih_rna_sample_00183_23KKJ7LT4_1_1																											133.8bp	68.0%	66.2M																55.0%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00183_23KKJ7LT4_1_2																																													53.0%	53%	151bp	151bp	45%	100.0M
tih_rna_sample_00183_23KKJ7LT4_1_trimmed_1																																													54.3%	52%	124bp	132bp	18%	97.5M	54.3%	52%	124bp	132bp	18%	97.5M
tih_rna_sample_00183_23KKJ7LT4_1_trimmed_2																																													52.8%	52%	125bp	132bp	9%	97.5M	52.8%	52%	125bp	132bp	9%	97.5M
tih_rna_sample_00184_23KKJ7LT4_1	197287004	0.02	144621776	0.27	1	0	0.98	176.58	72.00	1	0	0.000	141.3bp	134.0bp	0.62%	0.58%	0.55%	0.00%	1.32%	1.88%	0.78%	0.00%	No	0.00%	9999000000	350322085				145bp	199bp	27.3%	0.0%	76.6%	80.6%	91.9%	90.7M	16.9%	97.9%	24897.7Mb	197.3M	55.2%	98.6%	57.9%
tih_rna_sample_00184_23KKJ7LT4_1_1																											141.3bp	75.4%	74.3M																57.8%	54%	151bp	151bp	27%	100.0M
tih_rna_sample_00184_23KKJ7LT4_1_2																																													56.0%	55%	151bp	151bp	27%	100.0M
tih_rna_sample_00184_23KKJ7LT4_1_trimmed_1																																													57.7%	55%	129bp	142bp	18%	98.6M	57.7%	55%	129bp	142bp	18%	98.6M
tih_rna_sample_00184_23KKJ7LT4_1_trimmed_2																																													56.3%	55%	129bp	142bp	9%	98.6M	56.3%	55%	129bp	142bp	9%	98.6M
tih_rna_sample_00185_23KKJ7LT4_1	196991434	0.02	139222770	0.29	0	1	0.98	112.59	52.00	1	0	0.000	132.8bp	127.0bp	0.82%	0.90%	0.62%	0.00%	1.91%	2.89%	0.84%	0.00%	No	0.00%	9999000000	287856494				132bp	155bp	29.8%	0.0%	61.5%	83.6%	93.6%	92.2M	18.1%	97.8%	24068.6Mb	197.0M	49.6%	98.5%	64.6%
tih_rna_sample_00185_23KKJ7LT4_1_1																											132.8bp	60.6%	59.7M																49.7%	50%	151bp	151bp	18%	100.0M
tih_rna_sample_00185_23KKJ7LT4_1_2																																													47.0%	50%	151bp	151bp	18%	100.0M
tih_rna_sample_00185_23KKJ7LT4_1_trimmed_1																																													49.4%	49%	125bp	132bp	9%	98.5M	49.4%	49%	125bp	132bp	9%	98.5M
tih_rna_sample_00185_23KKJ7LT4_1_trimmed_2																																													47.0%	49%	125bp	132bp	0%	98.5M	47.0%	49%	125bp	132bp	0%	98.5M
tih_rna_sample_00186_23KKJ7LT4_1	197717716	0.01	138006978	0.30	1	0	0.98	200.24	82.00	1	0	0.000	155.6bp	145.0bp	1.55%	0.89%	0.57%	0.00%	3.12%	2.51%	0.71%	0.00%	No	0.00%	9999000000	328640585				163bp	279bp	30.5%	0.0%	81.6%	85.9%	94.4%	93.3M	20.4%	98.0%	25997.8Mb	197.7M	53.3%	98.9%	48.2%
tih_rna_sample_00186_23KKJ7LT4_1_1																											155.6bp	80.4%	79.5M																63.1%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00186_23KKJ7LT4_1_2																																													60.6%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00186_23KKJ7LT4_1_trimmed_1																																													63.1%	53%	134bp	151bp	18%	98.9M	63.1%	53%	134bp	151bp	18%	98.9M
tih_rna_sample_00186_23KKJ7LT4_1_trimmed_2																																													60.9%	53%	134bp	151bp	9%	98.9M	60.9%	53%	134bp	151bp	9%	98.9M
tih_rna_sample_00198_23KKJ7LT4_1	195777452	0.02	126334626	0.35	0	0	0.98	99.57	46.00	1	0	0.000	124.5bp	120.0bp	1.35%	0.78%	0.66%	0.00%	2.88%	2.29%	0.85%	0.00%	No	0.00%	9999000000	209972851				122bp	143bp	36.2%	0.0%	66.5%	80.1%	92.4%	90.4M	21.9%	98.0%	22980.6Mb	195.8M	50.3%	97.9%	72.7%
tih_rna_sample_00198_23KKJ7LT4_1_1																											124.5bp	65.5%	64.1M																54.5%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00198_23KKJ7LT4_1_2																																													52.1%	51%	151bp	151bp	45%	100.0M
tih_rna_sample_00198_23KKJ7LT4_1_trimmed_1																																													54.0%	50%	120bp	122bp	18%	97.9M	54.0%	50%	120bp	122bp	18%	97.9M
tih_rna_sample_00198_23KKJ7LT4_1_trimmed_2																																													52.0%	50%	120bp	122bp	9%	97.9M	52.0%	50%	120bp	122bp	9%	97.9M
tih_rna_sample_00200_23KKJ7LT4_1	184905530	0.05	67817988	0.63	0	1	0.98	31.58	11.00	0	0	0.000	136.1bp	130.0bp	2.37%	0.44%	0.29%	0.00%	4.80%	1.24%	0.41%	0.00%	No	0.00%	9999000000	54195428				134bp	154bp	66.9%	0.0%	64.1%	71.1%	86.6%	80.1M	45.5%	97.3%	22432.3Mb	184.9M	55.6%	92.5%	62.4%
tih_rna_sample_00200_23KKJ7LT4_1_1																											136.1bp	59.0%	54.6M																72.4%	56%	151bp	151bp	45%	100.0M
tih_rna_sample_00200_23KKJ7LT4_1_2																																													70.0%	58%	151bp	151bp	45%	100.0M
tih_rna_sample_00200_23KKJ7LT4_1_trimmed_1																																													70.4%	55%	124bp	132bp	18%	92.5M	70.4%	55%	124bp	132bp	18%	92.5M
tih_rna_sample_00200_23KKJ7LT4_1_trimmed_2																																													69.0%	55%	125bp	132bp	9%	92.5M	69.0%	55%	125bp	132bp	9%	92.5M
tih_rna_sample_00202_23KKJ7LT4_1	197235910	0.01	147831595	0.25	1	0	0.98	183.23	84.00	1	0	0.000	148.6bp	137.0bp	0.95%	0.85%	0.67%	0.00%	2.02%	2.55%	0.86%	0.00%	No	0.00%	9990000000	374205550				149bp	215bp	25.3%	0.0%	74.2%	86.7%	94.8%	93.5M	16.8%	98.1%	25258.8Mb	197.2M	50.9%	98.6%	53.1%
tih_rna_sample_00202_23KKJ7LT4_1_1																											148.6bp	73.2%	72.2M																58.4%	51%	151bp	151bp	27%	100.0M
tih_rna_sample_00202_23KKJ7LT4_1_2																																													54.5%	51%	151bp	151bp	18%	100.0M
tih_rna_sample_00202_23KKJ7LT4_1_trimmed_1																																													58.2%	50%	130bp	147bp	18%	98.6M	58.2%	50%	130bp	147bp	18%	98.6M
tih_rna_sample_00202_23KKJ7LT4_1_trimmed_2																																													54.7%	51%	131bp	147bp	9%	98.6M	54.7%	51%	131bp	147bp	9%	98.6M
tih_rna_sample_00204_23KKJ7LT4_1	13030866	0.14	6756294	0.48	0	1	0.98	1.02	0.00	0	0	0.000	99.9bp	97.0bp	1.84%	0.51%	0.65%	0.00%	3.45%	1.34%	0.73%	0.00%	No	0.00%	9999000000	4929344				94bp	97bp	56.0%	0.0%	39.4%	46.7%	73.5%	4.8M	56.0%	97.3%	1240.5Mb	13.0M	50.9%	38.3%	63.9%
tih_rna_sample_00204_23KKJ7LT4_1_1																											99.9bp	33.4%	2.2M																84.2%	65%	151bp	151bp	55%	17.0M
tih_rna_sample_00204_23KKJ7LT4_1_2																																													83.1%	80%	151bp	151bp	55%	17.0M
tih_rna_sample_00204_23KKJ7LT4_1_trimmed_1																																													57.1%	50%	98bp	97bp	18%	6.5M	57.1%	50%	98bp	97bp	18%	6.5M
tih_rna_sample_00204_23KKJ7LT4_1_trimmed_2																																													56.8%	51%	98bp	102bp	18%	6.5M	56.8%	51%	98bp	102bp	18%	6.5M
tih_rna_sample_00206_23KKJ7LT4_1	197783962	0.01	143476325	0.27	1	0	0.98	202.89	95.00	1	0	0.000	164.8bp	152.0bp	0.73%	0.85%	0.45%	0.00%	1.68%	2.82%	0.65%	0.00%	No	0.00%	9999000000	344080782				178bp	285bp	27.7%	0.0%	76.8%	86.7%	94.7%	93.7M	19.3%	98.0%	26578.4Mb	197.8M	53.5%	98.9%	41.0%
tih_rna_sample_00206_23KKJ7LT4_1_1																											164.8bp	76.3%	75.4M																59.2%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00206_23KKJ7LT4_1_2																																													56.6%	53%	151bp	151bp	18%	100.0M
tih_rna_sample_00206_23KKJ7LT4_1_trimmed_1																																													59.2%	53%	137bp	151bp	18%	98.9M	59.2%	53%	137bp	151bp	18%	98.9M
tih_rna_sample_00206_23KKJ7LT4_1_trimmed_2																																													56.9%	53%	137bp	151bp	9%	98.9M	56.9%	53%	137bp	151bp	9%	98.9M
tih_rna_sample_00207_23KKJ7LT4_1	196584812	0.02	133796157	0.32	1	0	0.98	136.48	58.00	1	0	0.000	139.0bp	130.0bp	1.41%	0.46%	0.45%	0.00%	2.76%	1.33%	0.61%	0.00%	No	0.00%	9990000000	254207246				136bp	170bp	32.5%	0.0%	70.2%	80.6%	92.8%	91.2M	21.0%	97.9%	24458.2Mb	196.6M	52.8%	98.3%	60.2%
tih_rna_sample_00207_23KKJ7LT4_1_1																											139.0bp	68.1%	67.0M																56.4%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00207_23KKJ7LT4_1_2																																													53.4%	53%	151bp	151bp	27%	100.0M
tih_rna_sample_00207_23KKJ7LT4_1_trimmed_1																																													56.1%	52%	127bp	137bp	18%	98.3M	56.1%	52%	127bp	137bp	18%	98.3M
tih_rna_sample_00207_23KKJ7LT4_1_trimmed_2																																													53.6%	53%	127bp	137bp	9%	98.3M	53.6%	53%	127bp	137bp	9%	98.3M
tih_rna_sample_00234_23KKJ7LT4_1	197197434	0.01	143464813	0.27	1	0	0.98	167.20	63.00	1	0	0.000	138.3bp	130.0bp	1.32%	0.66%	0.74%	0.00%	2.86%	2.00%	0.99%	0.00%	No	0.00%	9999000000	331674860				140bp	189bp	27.6%	0.0%	75.6%	84.9%	94.2%	92.9M	16.7%	98.1%	24589.0Mb	197.2M	51.9%	98.6%	60.2%
tih_rna_sample_00234_23KKJ7LT4_1_1																											138.3bp	74.3%	73.2M																57.0%	52%	151bp	151bp	27%	100.0M
tih_rna_sample_00234_23KKJ7LT4_1_2																																													55.1%	52%	151bp	151bp	18%	100.0M
tih_rna_sample_00234_23KKJ7LT4_1_trimmed_1																																													56.8%	51%	127bp	137bp	18%	98.6M	56.8%	51%	127bp	137bp	18%	98.6M
tih_rna_sample_00234_23KKJ7LT4_1_trimmed_2																																													55.3%	52%	127bp	137bp	9%	98.6M	55.3%	52%	127bp	137bp	9%	98.6M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: SeqTools	Reads	SeqTools Reads	`reads`	None
\|\|	Custom content: SeqTools	Frac Unmapped	SeqTools Frac Unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools	Unique Reads	SeqTools Unique Reads	`unique_reads`	None
\|\|	Custom content: SeqTools	Frac Dupes	SeqTools Frac Dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools	Frac Reads On Target	SeqTools Frac Reads On Target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools	Frac Reads Off Target	SeqTools Frac Reads Off Target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools	N Q30	SeqTools N Q30	`n_q30`	None
\|\|	Custom content: SeqTools	Mean Depth	SeqTools Mean Depth	`mean_depth`	None
\|\|	Custom content: SeqTools	Q50 Depth	SeqTools Q50 Depth	`q50_depth`	None
\|\|	Custom content: SeqTools	Frac Bases Gt30X	SeqTools Frac Bases Gt30X	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools	Frac Bases Gt100X	SeqTools Frac Bases Gt100X	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools	GC Bias	Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_02_RNA_0005_23KKJ7LT4_1	220.8M	0.0M	0.0M	22.3M	1.7M	188.5M	94.3M	94.2M	94.2M	94.2M	107.3M	81.1M	187.8M	0.0M
FFPE_V4_0001_RNA_0003_23KKJ7LT4_1	222.6M	0.0M	0.0M	24.6M	2.3M	186.6M	93.3M	93.2M	93.3M	93.3M	112.7M	73.8M	186.0M	0.0M
NTC_0001_0001_23KKJ7LT4_1	2.6M	0.0M	0.0M	1.7M	0.5M	0.1M	0.0M	0.0M	0.0M	0.0M	0.1M	0.0M	0.1M	0.0M
tih_rna_sample_00001_23KKJ7LT4_1	222.8M	0.0M	0.0M	25.3M	3.6M	184.2M	92.2M	92.1M	92.1M	92.1M	123.4M	60.9M	183.6M	0.0M
tih_rna_sample_00002_23KKJ7LT4_1	218.6M	0.0M	0.0M	20.0M	2.2M	189.1M	94.6M	94.5M	94.6M	94.6M	136.8M	52.4M	188.3M	0.0M
tih_rna_sample_00004_23KKJ7LT4_1	221.0M	0.0M	0.0M	22.5M	2.3M	188.1M	94.1M	94.0M	94.1M	94.1M	122.3M	65.8M	187.4M	0.0M
tih_rna_sample_00005_23KKJ7LT4_1	226.6M	0.0M	0.0M	37.7M	5.5M	171.6M	85.8M	85.8M	85.8M	85.8M	115.3M	56.2M	170.8M	0.0M
tih_rna_sample_00006_23KKJ7LT4_1	229.4M	0.0M	0.0M	31.3M	3.6M	184.4M	92.3M	92.1M	92.2M	92.2M	120.8M	63.6M	183.5M	0.0M
tih_rna_sample_00007_23KKJ7LT4_1	222.3M	0.0M	0.0M	25.0M	2.8M	185.1M	92.6M	92.5M	92.5M	92.5M	128.0M	57.1M	184.3M	0.0M
tih_rna_sample_00008_23KKJ7LT4_1	172.9M	0.0M	0.0M	31.5M	5.2M	127.0M	63.5M	63.5M	63.5M	63.5M	108.5M	18.5M	126.3M	0.0M
tih_rna_sample_00009_23KKJ7LT4_1	233.5M	0.0M	0.0M	37.6M	7.8M	175.4M	87.8M	87.6M	87.7M	87.7M	123.4M	52.0M	174.7M	0.0M
tih_rna_sample_00010_23KKJ7LT4_1	218.8M	0.0M	0.0M	20.1M	2.5M	189.0M	94.6M	94.4M	94.5M	94.5M	117.3M	71.8M	188.1M	0.0M
tih_rna_sample_00012_23KKJ7LT4_1	223.0M	0.0M	0.0M	25.3M	4.0M	185.0M	92.5M	92.4M	92.5M	92.5M	125.7M	59.3M	184.1M	0.0M
tih_rna_sample_00013_23KKJ7LT4_1	225.9M	0.0M	0.0M	29.1M	4.5M	182.6M	91.4M	91.3M	91.3M	91.3M	131.2M	51.4M	181.8M	0.0M
tih_rna_sample_00015_23KKJ7LT4_1	220.5M	0.0M	0.0M	21.9M	2.1M	188.5M	94.3M	94.2M	94.3M	94.2M	116.9M	71.6M	187.7M	0.0M
tih_rna_sample_00016_23KKJ7LT4_1	233.4M	0.0M	0.0M	40.2M	6.9M	173.6M	86.9M	86.7M	86.8M	86.8M	134.6M	39.0M	172.9M	0.0M
tih_rna_sample_00020_23KKJ7LT4_1	225.1M	0.0M	0.0M	27.5M	3.3M	184.7M	92.4M	92.3M	92.3M	92.3M	123.5M	61.1M	184.0M	0.0M
tih_rna_sample_00021_23KKJ7LT4_1	223.8M	0.0M	0.0M	25.4M	2.1M	187.3M	93.7M	93.6M	93.7M	93.7M	117.7M	69.6M	186.6M	0.0M
tih_rna_sample_00022_23KKJ7LT4_1	222.7M	0.0M	0.0M	25.8M	3.9M	183.6M	91.9M	91.7M	91.8M	91.8M	118.4M	65.2M	182.9M	0.0M
tih_rna_sample_00023_23KKJ7LT4_1	221.9M	0.0M	0.0M	23.3M	2.3M	187.6M	93.9M	93.7M	93.8M	93.8M	130.7M	56.9M	186.8M	0.0M
tih_rna_sample_00024_23KKJ7LT4_1	233.7M	0.0M	0.0M	36.6M	6.3M	178.8M	89.5M	89.3M	89.4M	89.4M	122.6M	56.1M	178.0M	0.0M
tih_rna_sample_00025_23KKJ7LT4_1	222.5M	0.0M	0.0M	24.2M	2.5M	187.3M	93.7M	93.6M	93.7M	93.7M	130.2M	57.2M	186.5M	0.0M
tih_rna_sample_00027_23KKJ7LT4_1	218.1M	0.0M	0.0M	19.6M	2.2M	189.4M	94.8M	94.7M	94.7M	94.7M	137.7M	51.7M	188.5M	0.0M
tih_rna_sample_00030_23KKJ7LT4_1	217.4M	0.0M	0.0M	18.9M	2.2M	189.4M	94.7M	94.6M	94.7M	94.7M	120.1M	69.3M	188.6M	0.0M
tih_rna_sample_00032_23KKJ7LT4_1	218.8M	0.0M	0.0M	20.5M	1.9M	188.9M	94.5M	94.4M	94.4M	94.4M	119.1M	69.8M	188.3M	0.0M
tih_rna_sample_00034_23KKJ7LT4_1	241.1M	0.0M	0.0M	45.7M	11.0M	169.8M	85.0M	84.8M	84.9M	84.9M	121.1M	48.6M	169.0M	0.0M
tih_rna_sample_00035_23KKJ7LT4_1	218.8M	0.0M	0.0M	22.2M	2.7M	186.0M	93.0M	92.9M	93.0M	93.0M	127.7M	58.3M	185.4M	0.0M
tih_rna_sample_00036_23KKJ7LT4_1	230.8M	0.0M	0.0M	34.9M	5.7M	179.5M	89.8M	89.6M	89.7M	89.7M	140.0M	39.5M	178.6M	0.0M
tih_rna_sample_00037_23KKJ7LT4_1	217.9M	0.0M	0.0M	19.2M	2.2M	189.1M	94.6M	94.5M	94.5M	94.5M	126.7M	62.4M	188.3M	0.0M
tih_rna_sample_00039_23KKJ7LT4_1	224.2M	0.0M	0.0M	26.7M	3.8M	184.2M	92.2M	92.1M	92.1M	92.1M	125.7M	58.5M	183.7M	0.0M
tih_rna_sample_00041_23KKJ7LT4_1	221.8M	0.0M	0.0M	24.5M	2.9M	185.9M	93.0M	92.9M	92.9M	92.9M	132.2M	53.6M	185.2M	0.0M
tih_rna_sample_00042_23KKJ7LT4_1	221.0M	0.0M	0.0M	23.7M	2.4M	186.8M	93.5M	93.4M	93.4M	93.4M	131.5M	55.3M	186.2M	0.0M
tih_rna_sample_00043_23KKJ7LT4_1	218.2M	0.0M	0.0M	20.4M	2.2M	188.4M	94.2M	94.1M	94.2M	94.2M	127.8M	60.6M	187.8M	0.0M
tih_rna_sample_00170_23KKJ7LT4_1	222.6M	0.0M	0.0M	23.9M	2.3M	187.9M	94.0M	93.9M	94.0M	94.0M	154.3M	33.6M	187.1M	0.0M
tih_rna_sample_00176_23KKJ7LT4_1	237.9M	0.0M	0.0M	45.7M	8.8M	168.8M	84.5M	84.3M	84.4M	84.4M	123.3M	45.4M	168.0M	0.0M
tih_rna_sample_00179_23KKJ7LT4_1	233.2M	0.0M	0.0M	36.2M	4.5M	180.0M	90.1M	90.0M	90.0M	90.0M	116.3M	63.8M	179.4M	0.0M
tih_rna_sample_00180_23KKJ7LT4_1	237.5M	0.0M	0.0M	39.9M	6.4M	177.8M	89.0M	88.8M	88.9M	88.9M	116.7M	61.2M	177.1M	0.0M
tih_rna_sample_00183_23KKJ7LT4_1	227.3M	0.0M	0.0M	31.2M	3.7M	182.4M	91.3M	91.2M	91.2M	91.2M	128.9M	53.5M	181.6M	0.0M
tih_rna_sample_00184_23KKJ7LT4_1	226.8M	0.0M	0.0M	28.4M	4.6M	183.6M	91.9M	91.7M	91.8M	91.8M	119.4M	64.1M	182.8M	0.0M
tih_rna_sample_00185_23KKJ7LT4_1	222.4M	0.0M	0.0M	24.3M	3.2M	186.7M	93.4M	93.3M	93.4M	93.3M	140.8M	45.9M	185.9M	0.0M
tih_rna_sample_00186_23KKJ7LT4_1	218.7M	0.0M	0.0M	20.1M	2.0M	188.5M	94.3M	94.2M	94.2M	94.2M	111.9M	76.6M	187.8M	0.0M
tih_rna_sample_00198_23KKJ7LT4_1	227.9M	0.0M	0.0M	30.8M	3.7M	183.4M	91.8M	91.6M	91.7M	91.7M	133.4M	50.0M	182.5M	0.0M
tih_rna_sample_00200_23KKJ7LT4_1	227.1M	0.0M	0.0M	41.2M	9.9M	162.0M	81.1M	80.9M	81.0M	81.0M	125.1M	36.9M	161.4M	0.0M
tih_rna_sample_00202_23KKJ7LT4_1	217.0M	0.0M	0.0M	18.9M	2.1M	188.9M	94.5M	94.4M	94.4M	94.4M	123.3M	65.5M	188.2M	0.0M
tih_rna_sample_00204_23KKJ7LT4_1	20.7M	0.0M	0.0M	7.6M	1.8M	9.7M	4.9M	4.9M	4.9M	4.9M	8.8M	1.0M	9.7M	0.0M
tih_rna_sample_00206_23KKJ7LT4_1	217.7M	0.0M	0.0M	19.1M	2.0M	189.4M	94.7M	94.7M	94.7M	94.7M	117.6M	71.8M	188.7M	0.0M
tih_rna_sample_00207_23KKJ7LT4_1	227.8M	0.0M	0.0M	30.3M	3.1M	184.3M	92.2M	92.1M	92.2M	92.2M	131.4M	52.9M	183.6M	0.0M
tih_rna_sample_00234_23KKJ7LT4_1	220.6M	0.0M	0.0M	22.3M	2.5M	188.1M	94.1M	94.0M	94.1M	94.0M	123.0M	65.1M	187.3M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	77228903	0.4249%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	8	965375	0.0053%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	6	49680	0.0003%
GGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGCGTGGGGGGG	5	573804	0.0032%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	32438	0.0002%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	5143	0.0000%
TAGGTTTCGGTTTCGGTT	2	3765	0.0000%
AACCGAAACCGAAACCTA	2	3767	0.0000%
GCCCCCCCGGCAGCAGC	2	1269	0.0000%
GCTGCTGCCGGGGGGGCC	2	1267	0.0000%
GGCCCCCCCGGCAGCAGC	2	1265	0.0000%
GCTGCTGCCGGGGGGGC	2	1288	0.0000%
GCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAG	2	224493	0.0012%
GGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGC	2	231881	0.0013%
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT	2	233543	0.0013%
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG	2	199294	0.0011%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGGATTGTCATCTAGG	1	254363	0.0014%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGGATTGTCATCTAGT	1	159249	0.0009%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGCGGACTATCTAGT	1	147517	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACTTAGAATCTGGG	1	332295	0.0018%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	48	10546711	0.1175%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	33989	0.0004%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	4	480989	0.0054%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	3	24526	0.0003%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	5143	0.0001%
TAGGTTTCGGTTTCGGTT	2	3765	0.0000%
AACCGAAACCGAAACCTA	2	3767	0.0000%
GCCCCCCCGGCAGCAGC	2	1269	0.0000%
GCTGCTGCCGGGGGGGCC	2	1267	0.0000%
GGCCCCCCCGGCAGCAGC	2	1265	0.0000%
GCTGCTGCCGGGGGGGC	2	1288	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	1	5113	0.0001%
GGGGGAGAGAGAGAGAGAGAGGGCGCGAAG	1	2705	0.0000%
GGGGAGAGAGAGAGAGAGAGGGCGCGAAG	1	1158	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	1	1120	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACAGGCAATCGCATCTAG	1	896	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGGCAATCGCATCTAGGG	1	811	0.0000%
GCCCCCCCGGCAGCAGCAC	1	751	0.0000%
GGGGGAGAGAGAGAGAGAGAGGGCGC	1	746	0.0000%
GCGCCCTCTCTCTCTCTCTCTCCCCCGC	1	721	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER_SAME_GENE	awk	`filter same-gene (gene1==gene2)`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION_CRAM	samtools	`1.17`
SAMTOOLS_SORT_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_STARFUSION	samtools	`1.17`
SEQTK_SAMPLE	seqtk	`1.4.post122`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_FOR_ARRIBA	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
STAR_FOR_STARFUSION	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0006/A23KKJ7LT4//nfcore_rnafusion_100M__5f1fa79--20260304-101508' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,debugging -name dev_rna_exp0006-5f1fa79 --input 's3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260107_LH00166_0227_A23KKJ7LT4__497a58ff--20260112-201924/samplesheets/rnaseq_samplesheetdev_rna_exp0006.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0006/A23KKJ7LT4//nfcore_rnafusion_100M__5f1fa79--20260304-101508' -resume 143eba11-11cc-4480-a119-8b4128560dcb

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0006-5f1fa79
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,debugging
configFiles: N/A

Input/output options

input: s3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260107_LH00166_0227_A23KKJ7LT4__497a58ff--20260112-201924/samplesheets/rnaseq_samplesheetdev_rna_exp0006.csv
outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0006/A23KKJ7LT4//nfcore_rnafusion_100M__5f1fa79--20260304-101508
strand: unknown
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks