File Info

Filename
NTC_0001_0001_23KKJ7LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0005/A23LGNLLT4/nfcore_rnafusion_100M__5f1fa79--20260304-101508/fastp/NTC_0001_0001_23KKJ7LT4_1.fastp.log
Size
1.5 KB
Published
Mar 04, 2026 10:26 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 6189071
total bases: 934549721
Q20 bases: 815745428(87.2875%)
Q30 bases: 637351711(68.1988%)

Read2 before filtering:
total reads: 6189071
total bases: 934549721
Q20 bases: 911683921(97.5533%)
Q30 bases: 820258028(87.7704%)

Read1 after filtering:
total reads: 405834
total bases: 36236451
Q20 bases: 35288749(97.3847%)
Q30 bases: 33645482(92.8498%)

Read2 after filtering:
total reads: 405834
total bases: 36938185
Q20 bases: 36343010(98.3887%)
Q30 bases: 34920517(94.5377%)

Filtering result:
reads passed filter: 811668
reads failed due to low quality: 154772
reads failed due to too many N: 136
reads failed due to too short: 11411566
reads with adapter trimmed: 6376918
bases trimmed due to adapters: 252666550

Duplication rate: 74.0861%

Insert size peak (evaluated by paired-end reads): 31

JSON report: NTC_0001_0001_23KKJ7LT4_1.fastp.json
HTML report: NTC_0001_0001_23KKJ7LT4_1.fastp.html

fastp --in1 NTC_0001_0001_23KKJ7LT4_1_1.fastq.gz --in2 NTC_0001_0001_23KKJ7LT4_1_2.fastq.gz --out1 NTC_0001_0001_23KKJ7LT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_23KKJ7LT4_1_2.fastp.fastq.gz --json NTC_0001_0001_23KKJ7LT4_1.fastp.json --html NTC_0001_0001_23KKJ7LT4_1.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 10 seconds