Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 15751549 total bases: 2378483899 Q20 bases: 2228165822(93.6801%) Q30 bases: 2022395234(85.0288%) Read2 before filtering: total reads: 15751549 total bases: 2378483899 Q20 bases: 2271833065(95.516%) Q30 bases: 2062625349(86.7202%) Read1 after filtering: total reads: 13073429 total bases: 1323854541 Q20 bases: 1315029059(99.3333%) Q30 bases: 1281810791(96.8241%) Read2 after filtering: total reads: 13073429 total bases: 1330346820 Q20 bases: 1316779397(98.9802%) Q30 bases: 1277768614(96.0478%) Filtering result: reads passed filter: 26146858 reads failed due to low quality: 616436 reads failed due to too many N: 14540 reads failed due to too short: 4725264 reads with adapter trimmed: 26307528 bases trimmed due to adapters: 1387840281 Duplication rate: 32.5293% Insert size peak (evaluated by paired-end reads): 99 JSON report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json HTML report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html fastp --in1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe fastp v0.23.4, time used: 32 seconds