Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 300000000 total bases: 45300000000 Q20 bases: 44413313371(98.0426%) Q30 bases: 42842080230(94.5741%) Read2 before filtering: total reads: 300000000 total bases: 45300000000 Q20 bases: 44371605248(97.9506%) Q30 bases: 42452660886(93.7145%) Read1 after filtering: total reads: 295379314 total bases: 37836735486 Q20 bases: 37641998736(99.4853%) Q30 bases: 36805243071(97.2738%) Read2 after filtering: total reads: 295379314 total bases: 37880529105 Q20 bases: 37577585624(99.2003%) Q30 bases: 36549837871(96.4871%) Filtering result: reads passed filter: 590758628 reads failed due to low quality: 7782794 reads failed due to too many N: 199022 reads failed due to too short: 1259556 reads with adapter trimmed: 342669977 bases trimmed due to adapters: 13629181154 Duplication rate: 24.7493% Insert size peak (evaluated by paired-end reads): 118 JSON report: KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.json HTML report: KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.html fastp --in1 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_1.fastq.gz --in2 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_2.fastq.gz --out1 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_1.fastp.fastq.gz --out2 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_2.fastp.fastq.gz --json KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.json --html KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 754 seconds