Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44313329710(97.8219%)
Q30 bases: 42589188114(94.0159%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44012846758(97.1586%)
Q30 bases: 41653233118(91.9497%)

Read1 after filtering:
total reads: 295208894
total bases: 36601997627
Q20 bases: 36415021849(99.4892%)
Q30 bases: 35604973396(97.276%)

Read2 after filtering:
total reads: 295208894
total bases: 36650413536
Q20 bases: 36347865154(99.1745%)
Q30 bases: 35322657719(96.3772%)

Filtering result:
reads passed filter: 590417788
reads failed due to low quality: 8074480
reads failed due to too many N: 191488
reads failed due to too short: 1316244
reads with adapter trimmed: 381023842
bases trimmed due to adapters: 16065656586

Duplication rate: 25.6747%

Insert size peak (evaluated by paired-end reads): 109

JSON report: NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html

fastp --in1 NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 760 seconds