Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44177774695(97.5227%)
Q30 bases: 42346886454(93.481%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44251209607(97.6848%)
Q30 bases: 42125147025(92.9915%)

Read1 after filtering:
total reads: 295312779
total bases: 36475414173
Q20 bases: 36266638718(99.4276%)
Q30 bases: 35367043022(96.9613%)

Read2 after filtering:
total reads: 295312779
total bases: 36527757561
Q20 bases: 36234128490(99.1961%)
Q30 bases: 35208349780(96.3879%)

Filtering result:
reads passed filter: 590625558
reads failed due to low quality: 7603738
reads failed due to too many N: 177354
reads failed due to too short: 1593350
reads with adapter trimmed: 388447159
bases trimmed due to adapters: 16344332954

Duplication rate: 26.1969%

Insert size peak (evaluated by paired-end reads): 108

JSON report: SW780_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: SW780_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html

fastp --in1 SW780_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 SW780_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 SW780_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 SW780_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json SW780_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html SW780_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 742 seconds