Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44319917632(97.8365%)
Q30 bases: 42646534606(94.1425%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44345960994(97.894%)
Q30 bases: 42364714153(93.5203%)

Read1 after filtering:
total reads: 295213067
total bases: 37451384231
Q20 bases: 37253605578(99.4719%)
Q30 bases: 36403759101(97.2027%)

Read2 after filtering:
total reads: 295213067
total bases: 37496310514
Q20 bases: 37183896985(99.1668%)
Q30 bases: 36119498550(96.3281%)

Filtering result:
reads passed filter: 590426134
reads failed due to low quality: 8070230
reads failed due to too many N: 193376
reads failed due to too short: 1310260
reads with adapter trimmed: 354357829
bases trimmed due to adapters: 14359501173

Duplication rate: 24.5444%

Insert size peak (evaluated by paired-end reads): 119

JSON report: MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html

fastp --in1 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 762 seconds