Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 4618078
total bases: 697329778
Q20 bases: 615378764(88.2479%)
Q30 bases: 480068955(68.8439%)
Read2 before filtering:
total reads: 4618078
total bases: 697329778
Q20 bases: 656800911(94.188%)
Q30 bases: 521689048(74.8124%)
Read1 after filtering:
total reads: 393174
total bases: 20091999
Q20 bases: 19174120(95.4316%)
Q30 bases: 17459945(86.9%)
Read2 after filtering:
total reads: 393174
total bases: 21135269
Q20 bases: 20597510(97.4556%)
Q30 bases: 19180231(90.7499%)
Filtering result:
reads passed filter: 786348
reads failed due to low quality: 403576
reads failed due to too many N: 252
reads failed due to too short: 8045980
reads with adapter trimmed: 4899325
bases trimmed due to adapters: 694184701
Duplication rate: 68.3963%
Insert size peak (evaluated by paired-end reads): 31
JSON report: A549_FFPE_01_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: A549_FFPE_01_RNA_0001_B23LG7FLT4_3.fastp.html
fastp --in1 A549_FFPE_01_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 A549_FFPE_01_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 A549_FFPE_01_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 A549_FFPE_01_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json A549_FFPE_01_RNA_0001_B23LG7FLT4_3.fastp.json --html A549_FFPE_01_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe
fastp v0.23.4, time used: 6 seconds