Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 17701448
total bases: 2672918648
Q20 bases: 2498132254(93.4608%)
Q30 bases: 2251546788(84.2355%)

Read2 before filtering:
total reads: 17701448
total bases: 2672918648
Q20 bases: 2532777304(94.757%)
Q30 bases: 2269255085(84.898%)

Read1 after filtering:
total reads: 14388080
total bases: 1419861525
Q20 bases: 1409987378(99.3046%)
Q30 bases: 1373891903(96.7624%)

Read2 after filtering:
total reads: 14388080
total bases: 1427555750
Q20 bases: 1412713642(98.9603%)
Q30 bases: 1369863383(95.9587%)

Filtering result:
reads passed filter: 28776160
reads failed due to low quality: 755948
reads failed due to too many N: 15416
reads failed due to too short: 5855372
reads with adapter trimmed: 29511802
bases trimmed due to adapters: 1614346759

Duplication rate: 32.6%

Insert size peak (evaluated by paired-end reads): 96

JSON report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json
HTML report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html

fastp --in1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_1.fastq.gz --in2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_2.fastq.gz --out1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json --html 22Rv1_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 46 seconds