Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 2980467
total bases: 450050517
Q20 bases: 406355936(90.2912%)
Q30 bases: 331540612(73.6674%)

Read2 before filtering:
total reads: 2980467
total bases: 450050517
Q20 bases: 433973982(96.4278%)
Q30 bases: 363232409(80.7093%)

Read1 after filtering:
total reads: 149272
total bases: 9971167
Q20 bases: 9577728(96.0542%)
Q30 bases: 8856748(88.8236%)

Read2 after filtering:
total reads: 149272
total bases: 10282945
Q20 bases: 10048074(97.7159%)
Q30 bases: 9446499(91.8657%)

Filtering result:
reads passed filter: 298544
reads failed due to low quality: 130750
reads failed due to too many N: 140
reads failed due to too short: 5531500
reads with adapter trimmed: 3069600
bases trimmed due to adapters: 438979572

Duplication rate: 76.94%

Insert size peak (evaluated by paired-end reads): 31

JSON report: A549_FFPE_01_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: A549_FFPE_01_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 A549_FFPE_01_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 A549_FFPE_01_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 A549_FFPE_01_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 A549_FFPE_01_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json A549_FFPE_01_RNA_0001_B23LG7FLT4_2.fastp.json --html A549_FFPE_01_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 8 seconds