Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 3995385
total bases: 603303135
Q20 bases: 516682950(85.6423%)
Q30 bases: 389144960(64.5024%)

Read2 before filtering:
total reads: 3995385
total bases: 603303135
Q20 bases: 565495973(93.7333%)
Q30 bases: 450466516(74.6667%)

Read1 after filtering:
total reads: 315474
total bases: 17390656
Q20 bases: 16502826(94.8948%)
Q30 bases: 14972880(86.0973%)

Read2 after filtering:
total reads: 315474
total bases: 18262793
Q20 bases: 17732390(97.0957%)
Q30 bases: 16471919(90.1939%)

Filtering result:
reads passed filter: 630948
reads failed due to low quality: 382944
reads failed due to too many N: 204
reads failed due to too short: 6976674
reads with adapter trimmed: 4217076
bases trimmed due to adapters: 598216182

Duplication rate: 56.5411%

Insert size peak (evaluated by paired-end reads): 31

JSON report: A549_FFPE_01_RNA_0001_B23LG7FLT4_1.fastp.json
HTML report: A549_FFPE_01_RNA_0001_B23LG7FLT4_1.fastp.html

fastp --in1 A549_FFPE_01_RNA_0001_B23LG7FLT4_1_1.fastq.gz --in2 A549_FFPE_01_RNA_0001_B23LG7FLT4_1_2.fastq.gz --out1 A549_FFPE_01_RNA_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 A549_FFPE_01_RNA_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json A549_FFPE_01_RNA_0001_B23LG7FLT4_1.fastp.json --html A549_FFPE_01_RNA_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 10 seconds