Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 19058536 total bases: 2877838936 Q20 bases: 2586315856(89.8701%) Q30 bases: 2139978171(74.3606%) Read2 before filtering: total reads: 19058536 total bases: 2877838936 Q20 bases: 2781310076(96.6458%) Q30 bases: 2459689087(85.47%) Read1 after filtering: total reads: 9095254 total bases: 746291045 Q20 bases: 741499546(99.358%) Q30 bases: 723949517(97.0063%) Read2 after filtering: total reads: 9095254 total bases: 751275839 Q20 bases: 745420176(99.2206%) Q30 bases: 726670149(96.7248%) Filtering result: reads passed filter: 18190508 reads failed due to low quality: 530148 reads failed due to too many N: 3820 reads failed due to too short: 19392596 reads with adapter trimmed: 27639661 bases trimmed due to adapters: 1576965694 Duplication rate: 52.908% Insert size peak (evaluated by paired-end reads): 79 JSON report: ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json HTML report: ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html fastp --in1 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json --html ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 28 seconds