Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 15151093
total bases: 2287815043
Q20 bases: 2100732750(91.8227%)
Q30 bases: 1828040229(79.9033%)

Read2 before filtering:
total reads: 15151093
total bases: 2287815043
Q20 bases: 2178615949(95.2269%)
Q30 bases: 1905010003(83.2677%)

Read1 after filtering:
total reads: 9848892
total bases: 930847597
Q20 bases: 923558238(99.2169%)
Q30 bases: 898058623(96.4775%)

Read2 after filtering:
total reads: 9848892
total bases: 938379912
Q20 bases: 926979204(98.7851%)
Q30 bases: 896661649(95.5542%)

Filtering result:
reads passed filter: 19697784
reads failed due to low quality: 885710
reads failed due to too many N: 9710
reads failed due to too short: 9708982
reads with adapter trimmed: 23386059
bases trimmed due to adapters: 1286305508

Duplication rate: 40.1965%

Insert size peak (evaluated by paired-end reads): 86

JSON report: ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1.fastp.json --html ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 33 seconds