Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 23355997
total bases: 3526755547
Q20 bases: 3267679087(92.654%)
Q30 bases: 2872004587(81.4348%)

Read2 before filtering:
total reads: 23355997
total bases: 3526755547
Q20 bases: 3423874499(97.0828%)
Q30 bases: 3151898516(89.3711%)

Read1 after filtering:
total reads: 16435072
total bases: 1460990562
Q20 bases: 1453493298(99.4868%)
Q30 bases: 1422859673(97.3901%)

Read2 after filtering:
total reads: 16435072
total bases: 1468704642
Q20 bases: 1458000314(99.2712%)
Q30 bases: 1423549658(96.9255%)

Filtering result:
reads passed filter: 32870144
reads failed due to low quality: 545528
reads failed due to too many N: 7282
reads failed due to too short: 13289040
reads with adapter trimmed: 38425203
bases trimmed due to adapters: 2267232382

Duplication rate: 46.4077%

Insert size peak (evaluated by paired-end reads): 85

JSON report: HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.json --html HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 48 seconds