File Info

Filename
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:01 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 16695125
total bases: 2520963875
Q20 bases: 2296673737(91.103%)
Q30 bases: 1967283866(78.037%)

Read2 before filtering:
total reads: 16695125
total bases: 2520963875
Q20 bases: 2455481979(97.4025%)
Q30 bases: 2244445329(89.0312%)

Read1 after filtering:
total reads: 10860033
total bases: 966183770
Q20 bases: 961189189(99.4831%)
Q30 bases: 940877029(97.3808%)

Read2 after filtering:
total reads: 10860033
total bases: 970670648
Q20 bases: 964124890(99.3256%)
Q30 bases: 941953484(97.0415%)

Filtering result:
reads passed filter: 21720066
reads failed due to low quality: 360214
reads failed due to too many N: 4946
reads failed due to too short: 11305024
reads with adapter trimmed: 26626544
bases trimmed due to adapters: 1537130582

Duplication rate: 46.061%

Insert size peak (evaluated by paired-end reads): 85

JSON report: OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.json --html OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 37 seconds