File Info

Filename
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:01 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 17839955
total bases: 2693833205
Q20 bases: 2483904457(92.2071%)
Q30 bases: 2166985102(80.4424%)

Read2 before filtering:
total reads: 17839955
total bases: 2693833205
Q20 bases: 2627481718(97.5369%)
Q30 bases: 2442687261(90.677%)

Read1 after filtering:
total reads: 12183393
total bases: 1096158804
Q20 bases: 1090318091(99.4672%)
Q30 bases: 1066823970(97.3239%)

Read2 after filtering:
total reads: 12183393
total bases: 1101216052
Q20 bases: 1093522698(99.3014%)
Q30 bases: 1067831589(96.9684%)

Filtering result:
reads passed filter: 24366786
reads failed due to low quality: 369132
reads failed due to too many N: 5386
reads failed due to too short: 10938606
reads with adapter trimmed: 28969272
bases trimmed due to adapters: 1670599126

Duplication rate: 47.8704%

Insert size peak (evaluated by paired-end reads): 85

JSON report: OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json --html OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 36 seconds