File Info

Filename
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:01 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 6491904
total bases: 980277504
Q20 bases: 858327308(87.5596%)
Q30 bases: 678498220(69.2149%)

Read2 before filtering:
total reads: 6491904
total bases: 980277504
Q20 bases: 940406294(95.9327%)
Q30 bases: 797038697(81.3075%)

Read1 after filtering:
total reads: 1433549
total bases: 106906095
Q20 bases: 105428066(98.6175%)
Q30 bases: 101635325(95.0697%)

Read2 after filtering:
total reads: 1433549
total bases: 108288645
Q20 bases: 107033177(98.8406%)
Q30 bases: 103449608(95.5314%)

Filtering result:
reads passed filter: 2867098
reads failed due to low quality: 295474
reads failed due to too many N: 968
reads failed due to too short: 9820268
reads with adapter trimmed: 7784924
bases trimmed due to adapters: 383802715

Duplication rate: 56.8865%

Insert size peak (evaluated by paired-end reads): 75

JSON report: OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json --html OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 15 seconds