File Info

Filename
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:01 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 10108986
total bases: 1526456886
Q20 bases: 1395119565(91.3959%)
Q30 bases: 1213942878(79.5268%)

Read2 before filtering:
total reads: 10108986
total bases: 1526456886
Q20 bases: 1450566180(95.0283%)
Q30 bases: 1275930600(83.5877%)

Read1 after filtering:
total reads: 6865293
total bases: 678663988
Q20 bases: 673579095(99.2507%)
Q30 bases: 655705918(96.6172%)

Read2 after filtering:
total reads: 6865293
total bases: 683337244
Q20 bases: 675015361(98.7822%)
Q30 bases: 652526642(95.4912%)

Filtering result:
reads passed filter: 13730586
reads failed due to low quality: 448240
reads failed due to too many N: 7656
reads failed due to too short: 6031490
reads with adapter trimmed: 15546570
bases trimmed due to adapters: 821532943

Duplication rate: 37.2803%

Insert size peak (evaluated by paired-end reads): 100

JSON report: SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.json --html SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 20 seconds