Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 17658335
total bases: 2666408585
Q20 bases: 2519234884(94.4805%)
Q30 bases: 2288995368(85.8456%)

Read2 before filtering:
total reads: 17658335
total bases: 2666408585
Q20 bases: 2561849539(96.0787%)
Q30 bases: 2320293362(87.0194%)

Read1 after filtering:
total reads: 13874867
total bases: 1384645434
Q20 bases: 1375502255(99.3397%)
Q30 bases: 1341426969(96.8787%)

Read2 after filtering:
total reads: 13874867
total bases: 1391777880
Q20 bases: 1377902213(99.003%)
Q30 bases: 1337556799(96.1042%)

Filtering result:
reads passed filter: 27749734
reads failed due to low quality: 764080
reads failed due to too many N: 14908
reads failed due to too short: 6787948
reads with adapter trimmed: 28948039
bases trimmed due to adapters: 1544906867

Duplication rate: 38.74%

Insert size peak (evaluated by paired-end reads): 94

JSON report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html

fastp --in1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html 22Rv1_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 37 seconds