Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 18721246
total bases: 2826908146
Q20 bases: 2653778189(93.8756%)
Q30 bases: 2379903283(84.1875%)

Read2 before filtering:
total reads: 18721246
total bases: 2826908146
Q20 bases: 2707865646(95.789%)
Q30 bases: 2416896192(85.4961%)

Read1 after filtering:
total reads: 14655979
total bases: 1385341228
Q20 bases: 1376897964(99.3905%)
Q30 bases: 1343433773(96.9749%)

Read2 after filtering:
total reads: 14655979
total bases: 1391795904
Q20 bases: 1379237923(99.0977%)
Q30 bases: 1339220347(96.2225%)

Filtering result:
reads passed filter: 29311958
reads failed due to low quality: 710936
reads failed due to too many N: 13582
reads failed due to too short: 7406016
reads with adapter trimmed: 31730954
bases trimmed due to adapters: 1788677399

Duplication rate: 34.8488%

Insert size peak (evaluated by paired-end reads): 86

JSON report: ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.json --html ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 44 seconds